Description :
From Genome Similarity Track
Location :
Scaffold_15:186287- 189418
Transcript NameFunction/comments
Phyke_g1343hypothetical protein PHYSODRAFT_262859
Phyke_g1344hypothetical protein

Sequence
3131 bases(100 bases per row)
ACGCGAGTTCAAGCGCGGCTGAAAGTTCGGATGGATCTTCCGACTCATTACATCATGGTGatctcaagaagaaagaaaagaagaaaaaggaagacaacag
cagcaatagcaacagtACGACAACGACTACAAGCAGTGAAATGAGCACTACTGCCAGTAGCAGTGATAGCGGTAGTAGCGGACTCGGGAGTAAAGGCATC
GGTGCGATTCTCAACCCTGGCGGCGTATCCGACGTCAACACAAGCTCAGCTACGTATTACAGTTTGGGCACAGGGTCAATTGTCGCGATTGTCGGCGTTG
TTGCAGGTATCTTGGGGATTCTGATGCTTTTTGTCGCCATCGGGCGCAAGAAGTACACGGAAGAGAACGACGAGAGCCCACTTCCGTACGGCTACAACAT
AGATATCCGGACTGTTCCACGACTCTCGCCGACCTTTATGCAGGATGATTCCTTTATGGAGAGTGGTTACAACATGAACAACTCGGCGTACATGGTTCCA
ATAGCGTACTCTGGTCAGTTCGATGGCACGTCTTCATCAGGAGGTGAAAGCTCGGATGAGGTACCATCACTTCGCGGAAATTTGATGGCCGCGAATGCGG
ACCCTATGGCAGATATTAGTTTACGAAGCCGAGTGCCGTCGGTGCAGAGTTTTAGTGGTGATTTAGACGCCGCTGGAGTGCGAATGTCGACACTGTACTC
CGGGTCATCATTAACGAGCGGAAGCGGGGTCAGCGGCTCCTGGAGCTCGGTGCTGGCATCGGACTGCGAGCGTCAGCCGTCACGCAACACGCGTGACACG
ACACTGAGCGCCTGGTCGGCAGCAAACCTGTcgtccttcagcagctccgccagCGGTGGGTCGGCGTACCGTATGACGCGATCGTCGACATTATCGACGG
ATCCCCGCCATACAGGGGGCAGCAACGACCATCAAGATCGTGTCAGGGGGTTATCTGCGTCGAGCTTAGCAGCCCACCAACCGAATCCAAATGTAAACGT
GCCGTCCAACCGCAGTAACAAGAGCACCGAGGTGTAAGACCCACATGGATGTTAATGTGTATGTACATAGAGTACGTGACGTGCGTGCGTGTGTGGGCAC
CGCATGCCGTATCGGCTGGACTGGACGAGGCAACGTCTTCCTCGAAGCGGAAGCATAGATGGTTGGCTGTGCGTTTACAGGCCTTTATATTAtttggatg
aagaagttcgacgtcgagagaagaagaggttgaaAGCAGGATTGCAAAGTGTTTGAAGGTAGGCGTGATTAGCAAAGGTAAACCTTTGAGACCTACTCAG
GTGAATTTAGCGTTCTTTTAGCGTTCATTTCACAGTTTGCAAAGTCCTTCCTGTTGATGAACTGCACTACGTAAATCGTAGAAGCACAACCGTGGAAACA
GTTCAtacaaaaagaaaaagtgGCTACAACTCAACTTGTTTTCCGCTTCAAGTGTAGCTTCTTGGAATCCCAAAGTTTTCGTGTGATGACTTCGTCCCGG
CGTTACCGACAGTGATTGTTGCAACTTTATCTCTTGAGGTGGCTCACATACTTGAATGTGAGGTAGATTGCTACCTGCACCACTGCCCAGATGACAATCA
GGCCGACCATGAAGTTGTACTTGCGCGTTGAACGGTGTATGCGACCGCTGTCATGTTCGTGGCGGCGCCGTTCTAAGTCACTGTCATGATGTCCTGGTTG
TCTCCAAACTGTACACCCATCAGTGCAGTCAACAAGTAACTTGACGGCATCAGGTACGTAAACCACTTGTAGCCGACCTTCATTGCCGTACGCGGCAACA
GGTAGCCACTGAACAGGTTGAGCAGACACGAAATCGCGCCCACAGCCACGTTTGCCACCTTTTCGTTTAGCATCAACGCTGACATCCATTGGCCAATGTA
CGTGCACGCTGACGTGTACAGGTAGAAGacgaacatgaagaagaagtcgtcAGCTTTGTCATTCCAATCCACCAGCCAGTACTCGATTGTCACGAACAGG
ATGATCACCACAATCAGGTAGGGAACCTCCGCGAACCACACCGATAGACTGTATGGCAGAGGTCCGTAGTAGTTCGACATGCGCTCGCGGTAGAACACTG
CACGCTCAGTACATGCTACTTTCAGCATTGTCATGAGATTGGTCACGCCGATGAAATCCATGTTGTTGTAGATGAGGCCGATGTGCGAATTAATCTTCAT
GCTGTCCGCCGACAATTGGTAGAACGTCGTGCCAAAGATGACCGCTATAATCGGATACAGGATGATTCGCATGAAATCGTACTGAGGGTTGCGCCACTAC
ATCaatcgctgcttcttggtgagcTCCCGAAGCTGGTTCCAGAAACTCGTCACGATCGGCTAGTAGTTCAGCGACGAGTGACACACAAAACCACTCGATA
CCtcgcacagctgcagcataCTCTCACGGTTTTTAGCGCATAGCGCACTGTTGGTGTACTCTACCGAGTAATCCTTCACATTACGTCCGATACTGTCGTC
GatcacctccagcatgtACGTGGCGGGGTTATACTGCGGCCGGATTTCTTCCGTTCCCGGGATGGAAGCAAAATATTCGAGCATTGTGACTGAGTCCACA
TCCAGGTCCCTTTTACAGTAGTAGCAGCCCGTCGAACAGCTCAAAGATCAAAATACTAGGTTGGTAAATCATGTACAACACCGTGCGCCCCGTACGAACG
ATCGCCTGTATACGACACATGATAATTAAAGCAGAACACGCGTCCAGACCGCTTGTCGGTTCGTCAAGAAACAGGATACTTGGGTTCGCTACCACCTCCA
CATTGATAGTCAacctttttgttttgttCCACTGCCAGACTTCCCACCATTTCGCCAGAGATCGCCGTCAATTCCAGGAGTTCGAGCATTTTATGCACGA
GGTTCATGCGCTCCTCCACCGTAAATTCCGGAGACAGACGTAGGTTTGCTGAAAACACCAGCGCTTCGTAGATTGTTGCGGCCTCAGAGTGGATGTCCAT
CTACTCGCAGTATGCCGTGATACGACTAAAGTTGGCCAGGTTCTTTAGTTCACCGTTCATGTAGATTTCGCCAACGATGCGGCCACCCGCCTTGCGACCG
GcaatcacatccatcagCGTTGTCTTGCCCG