Description :
From Genome Similarity Track
Location :
Scaffold_208:18624- 24673
Transcript NameFunction/comments
Physo_144602reverse transcriptase
Physo_125156reverse transcriptase

Sequence
6049 bases(100 bases per row)
GCTCAACCATCGGAAGTCCGCCGCGCGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAGTTCAGCGATCTAATGAGCGGCCCTGCGCGCCAATGG
TATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTGCGTGTGCAGTACTGCAGTAAGGGCGTGTCAATGGCCAGCCGCT
ACTACCATGCGGCTCAGCGCCCCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCGCGGGTTTGAGGGCCAACATCCCATACACCGAGGGTA
CGACTGAACAGAAGGGCGAAAACGTCGAGCATTTCATCCGGACGCTGAGCACGCAGGAGACCGAACTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGA
CTCCGAGGCGCTGGAGAAGAAACTGCGTGCCCGACAACGGGGACTGGCCCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCCAAAAGTAGCCG
ACCCCACCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTCGCGTCGGACGAGTACGACTCGGGACGCGAAAGTCGCGACAGCGACGATCGCCAGT
ACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGACAGGCCCCGCCGGGAGAGCCGGCGCGTCGCAACTTCGATCCCGACGACTT
GGGACGCGACCGCCCGCGGTGCCGCTACTGTGGTTCACGTCGCCATGTCGAAGGAGACTGCTGGAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCAC
CCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCAGGAGAATGCCCGATGGAGGAGTTCTTCAGCCAATTGCGCCAGTGGT
TTGACCCGAATAAACACGCGGGAATGCTGCTGCCGGCCGCCGAGAAGATGTCAAACTAGGACGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCT
GTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGAGAACCCGACTTCCCTGAATGATAATACATGTGAATTCAACCTGGAACGTG
CCACGCAAGAACGCGCGCGGCGAATCTCGGCGGTCCGATGTACGACGCACGTCGAGTTTGCACGTGAACCTCCCCTGGACGAGATCGAATTGCAACCAGG
AGAGCGACGCGGATACTGGAAACATTACTCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGAACGCTGAACAACCGCCGTGCTGTGTTATTGCTC
GACACAGGCGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGAAGGCTGCCTGATCGACACGGAGATCACGCAAGAGTGTGTGGGAATTCGTG
ATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTACCTTGGCTGGAAACTTGGTGGACTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCA
ACACACAATCCTCGGAATGAACTTCATGGTGCCCGCTGGAGTGCGGATCGACACTGCGGACGGCACGGCGTGCCTCCCCGACGAGGTGCATATCCAGATG
ATCGGACGAAGACCGCTATACAGCGCACGGATGCACCCGGTCGATGTCAAGACGCCTGTGAGACTCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGC
CGGATCGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAGTCGTGCGTGACTACCTTTGTCAAAGGGAGAGTCGGAAGGAAGACGTACCTGCGTGTCAC
GAACATCGGAGATGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTAGACGCCGTCTGACGGCCAGCCTCGGAACCGTGGATTCGTCCGACTG
GGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCACGACGCGGAGGAGAACTGGATCCCAGCCGAGCTGGACGGACCGATGACGG
ATCGCTCCTCATACCCGACGCCTAAAGCCTTCTTGCGCCCGGAGCCGAGACAACTCGGGACGCGACGCGCCGTGACCCCAGTGTTGGCGGCTGTCGTGGA
AGCGCCGAAGGCAAGGGGGGTAGACTTGCCACCCGACGACCACAAACCGGATACGAACGAGGAGGCGGTGGAAAGCGAACCCGATATGCCTCCGACTGTG
GCTGGAAGCACTGCGATGGAAGAATCGCCGAAATCGGAACTCGCCGAGCCAAAACTCGACGGACCAAACCCCGCCGAGCCGAATTTCGACGAGGCGAAAC
CTGATGAGCAGGAGGAAGACGATGCTGTCCTCATCCACGAGGGGTCCGACCTCTTCGCCGAGGATCTCGAGTCCGAGATGGCAGTGGTGTCACACCTCTC
GCTGACCGCCGAGGTGAAAATCGAAGACTTAAAGGTTGGCATGCCGACTGGACTCCCGCCCGAGGAAGCCGCAATACAAGAAACGCGGCTACGCCAAATC
GTCTGGAAGCGACGAAAGTGGTTGATCGACAAGGGCAACGCCTTGTCGCCAGCCGCCCTGGGTGTTGTCTGCGACATCGACGTGGGCGACGCAAAACCCG
TCGTGCAACGCGTCCGGAAAATCCCGCCGCAGTTCCGAGAGAAGGTCGCACACTTGATCAAGGGGCTGCTGAGCGCGACGATGATCCAGAAATCGAAGTC
GCCGTGGGCGTCGCCCATTGTCGTGATCATAAAGAAGAACGGCGTCGATATCCGGCTTTGCATTGACTACATGCTCATCAACGGGCTGACACAGTTGATG
GTTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCTATCGACATGGCGAGCGGCTTCTGGGTCGTCCCCA
TGACAAACCGGGCCCGGCTCATCTCAGCCTTCATCACGCCGATGGGACTGTACGAATGGTGCGTATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTAC
CAACGCTTGATCTGACAACGCGCTCTACGGGTTCATGAAGCTGTCCCCGGATGGCAGCACTCGGGACGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGT
ATTCACTCCGTTCTGGGACGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCA
CGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGTTTCATGT
CCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTCGCTTATCGTCCCCAAGCCAACGGTGCTGCAGAACGGATGGTGCA
GACGGTTACAAGAGCGATCAAGATGTACATCGCGGACGTCGACCAACGCGACTGGGACGAATACGCCGAGCGTCTTACCTTCGCGCTAAATACGTCGCAC
GACCGGACGAGGAACGAAACCCCGTTTTTCTTAGTGCGCGGCTGGGATCCTCGGTCGAGGCTGGAAGCGACGCCGGCCGTCGGGAACACGTCTACCCGGG
ACTCCGAGGCGAGGCGGTGGAAACTCCGCATCCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGGGAGGCCGTCGAAGAGAGAGC
GCGTCGACAAGCTGAAAACTCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCGCGCAAACTCATGCACAAGCTAACGCGT
TATATTTCTGAAAACTAGCTAACATTGATTGTAGAATGGATTAAGTCAATGACCAGCGACAGCTTCGACACAACCAAGGCAGGTGGCGCGAGTATGGCGC
TCAGACCAGCGCATATAGCCAAGTAGCTTGTTACAGTGATGAACGCACT