Description :
From Genome Similarity Track
Location :
Scaffold_201:18624- 19904
Transcript NameFunction/comments
Aphas_H257_18887AlNc14C170G7973
Aphas_H257_18888LigA protein

Sequence
1280 bases(100 bases per row)
TCTCGGCGTACGAGCCAAATGGAGTGTTTGTTTGTTGAAACGTGACGTCGGTGGCGTATCGAGCGAACGGGAAGTTCTTAAATTGATTCCCTGATGCGAT
CAGGTTCTTCATGGACCACTGCTCGGCAAGCTGAGCGACGTAGGACCGCATGAAGAAGGGGTGAACGGCCTTGATGTACCCAAGGACGCGCTTCTCGAAC
GTGGGAGGTTTCTGCGAGAAGACAAGGGCCACGACGTCCCAGTTGCCACAGTGCTTCATCGACGCAAGCATCATAAGGAGGAGGTCCCTTGCTGACACCT
CGGACTTTCGTCCAGACCCAACGTTCCAGTTCTTGGACACGAAATGGCGCAGGTCAGCCCACAAAAGATCGAACTCAGACGGCGAAAAGTTCGTGAGGGA
GAATATGCCTTCGGGACCTTGGGTTGAGAGAAAGGCGTCGTAGATGGGGGAGTTGGAGTCTGCATCCTCATCGGGCTCCTCTTGGCGCACAGTCGTGAAT
CGAGCGAGTTTGTCGCGGCGCTGTTGCTCGAGGTCCTCAAGCAAGGCCATGCCCCGCGTGAATGCACGTGTGTTTACATGCGATGGTTGTTGGGTGGGCT
GGGGTGTTGGCTGTGAAGGGCTCTGCGAGTCTTGCAAGCTGTATCGGCGAGGCATGGAGATAGTTTGGTGCGGGTTATTGGAGAACAAGCAGTGAATTCG
GAAGTGATTGAGTGTTTTCCAATTACATGGATGGATTTGAAAACGATGCGCGCCAAACGAATTCACCCAATCAACTGTAGGCAAATACATGTGTGCGCAT
AGTCGCGGCGCCTGTCGATTACTCGTATTGAAACCAATGATTTGGATTACTCCAAAATATTTGCGATAATCAAGAATATTAATTGTCACATGCAAATCAT
AGGATCGGTCATCAGGTGGTCTAATGAGAACGATGGGGGTTCGCATCGTGCGCTAACAGTACGACGCCCGCCAGCATCTGAAAGTTCATGGGCGCCATTT
GGCAAATTTTGGACTGAGGCCAAAAGGCTTGGTTGCCTCAACCTGTTGCAGAGGTTTTGACAACCGAGAACCGTAGAAACCATTTCTTTCGCGTCAAAGC
ACAACATGCAACTTCAGTGGTGCAAGGAGACGACAAGTCAAACATGTGAGATTATCAGCAATACGTTGGGAAGATGATTTCATTTTGATCGCCTTCCCTA
CTATTCCATAGTATATTTCCGAGGCCTGGCGCCAACCATAGACCATGAAAGGGACGTTCGTCATTGCATGGCATGGCTAC