Description :
From Genome Similarity Track
Location :
Scaffold_9:186236- 187685
Transcript NameFunction/comments
Sapdi_VS20SDRG_03754glycerophosphoryl diester phosphodiesterase
Sapdi_VS20SDRG_03755tRNA

Sequence
1449 bases(100 bases per row)
CGGCATTTGGCGCCAACGCAGTCTATCTCGACGATGCCAACACCGTCGACGAGCTGCCGTCACACGACCAGCTCGTAGGCTACAAGGCGGCCGGCATCAA
CATTGTGGCGCCGCCCATCTGGGCACTTCTGACGACGAACGGCGAGGATGGTCGCGTCGTGCCGTCCTTGTACGCACAGCACGTCAAAGCCGCCGGTCTC
CGCATCGTAGCGTGGAGCTTGGACCGCGCCGGTATCCTCGCCGAGACCCGCGGCGGGTGGTACTACCGGACCATTCAGAGTGCAATTGCGCGCGAAGGCG
ACATGCTCGAGACACTCCATGTGCTTACGCAGGACGTGGGCATCGAGTCAATCTTTGCCGACTGGGTCGCGACCCCCGTCTTTTACGCCAACTGCGTCGG
TCGAGCCTAACCGCCTCATGCATCTTGCATCTACGTACGAAGTTGTTGTCGACACTCATATGCCGCTGGTTGTGGTTTGGTGGTGCGACATGTCGAGTTG
ACGGGCTACGCTAATCGGTGAGGAAGCCAGGACGTGCAGCCCAAAAGCCGTCTTTGACCACGTCTTCGTGAAGAACGACGAGCGTCTTGTCTTGGCGCAG
CACCAACGAGCCTCGCTTGTAGATCGACTCGACGTCGTTGTAGTTGAGCTGGAAGCGAGAGAAGAGTAGCTCTTGCTTGTCTTTGGCGAGCGTCTTGCAC
AGCGTCGCTTCCGCTGCTTGCTTGGTCTCGCCTGCGCATCGCGTGAGCGACGACGATCACAATAGCAACTCAAGACTCACCGCTCTGCACCAGCAGCCAA
AAGCACGTGTTGTACATGTTGTTGATGTGGCAGTCCACTTGACGCCACGCGAGATAGTCGCGCAAGTTCTAGCACCATATCGACTATAGTTCTTTTTGGA
TATCCTAGTAAGAAATGTACCTTGGAGGACGGGTAGCAGACGACGCGCGAGTCAAACGCCGGCGGGTACTGCAGCGGCACGTCGCCAAAGAAGGCCGACC
AGTAGTAGACAAAGGACGACGTAAAGAGCGAGACAAACGTCGATGCGAGCTTGGTCGACCGGCGGCTGTACAAGCTGCTGCTCTTCTACTCAGGCGTGTG
AGCGACGCACGCGACCAGGCAGTCTACCGCAAGCACAAAGCTGTACTCGTCGCTCTGGCCGTACGCGACGACAATGTCGCCAAACTCGTGGCACACGCAG
GTTGCTGCCTACGCGACGTGGTCATTCGCGTGCTATGTAGACCAAGCGAACCTTGTTCATGAGGTGCAGGCCACGGAGGTCGTTGGGCTTGGCATAGCCG
TGGGCGTCCGTAAACCTACAGACACCACGATAGACAATGTGTGCATGCATCGACTGAATAGACCACTTCTTACTTGTGGAAGCCTTTGCCATCGACGCGC
ACGACGATCCACGTGTTGCGCAGGACTGGGTCCGGCAGCTCAAACTGGC