Description :
From Genome Similarity Track
Location :
Scaffold_134:186161- 189790
Transcript NameFunction/comments
Hyaar_Emoy2810703hypothetical protein

Sequence
3629 bases(100 bases per row)
CAAAATCGTGATTTTGTGCAGCCAAAGTTGTAACAGGGCACACCTTATTCAAGTAACTGAATAAACCTTGCACTGCTGACAGTGAAAGGGCGTGTGCTTC
CGACTACCTCACGTACACGTACGTGCGGAGGAGATTGCTATACGGAGTAAGAGTACTCAGTAAAGGTAAAAAGTAGAACTGTATTTAGTATAGTTAATCC
TTGTAATAAATCCCTATTTGACTTCATTTAACTATGTCTGAATACAAACATGTATTATAACTATCTGCGCGCCACTCGTTGCGTGCTTCTGTCGTGGCTA
GACTTTATTGGTTGATATCTTGATCCTATATCAACCAATGAGCAGTGTGTTACATCTGCGGGGCAATATTATCTATTAGGATAATATTGTGACAATATTG
TGTTTGTCCCAACGCAATATTCGTACTTGATGTTTACCTTATGTAAATTATCATGCAACGGGGGCACCCCGTTACATCACCCCCCCCTTAACCATCAGTC
ACATTAGTGACTGATTGATAATAAATGACATTGTTGAGTGGCTCTGGGACAGGGAAGCACTTGTTGGCCACTCCATCCATTATTCGTTCTCATCGCATGG
TTAACAAGTCCATGCGCTGTGCAGCCAAAGCTGCTGAGAAGGCAGCCATGAGACCCCGCTCTGCTGCCTTAGGGGAGACGGGATCACCCGAAGCAGCTGA
AGTAAGTTCTTCTGCTGCTTCCGCGACTCATCCTGCAGCAGTCGATGCTGCAGGCGCACACGGTGATGCACCGCGTGACATCGGAGATTATGAGCTTGAG
CTCATATACTCTGGTGAGTCTGACGGTGAGACCGACTCGAAGGAGGCGAAAGCCAAGGATGAGCCAGAATTGGCTAAACCGGAGCCGACTAAGTCGGCTT
CTCGAAGCGCTTCAAGCTTTGCAGATCGTCGTGACATCTTCGGATCGTCCGACTAGTCCGATCCTCCGTCTTCGAGACGGAGTCGTTCTGTCGAAAGCGA
GAGAAGGCATCAGAACGATCTTGACGGTGATACAATCATGCATCATAGTCCGAGTGATCGGGATGATCCTGGTGTCAGTACTTCTATTGACACCAGACAA
GAAACTGTGGATCGCAACATCTTGCGTGTTGCTCCCGAGAAGAAGCCGTGGCTACCTCCTCCGAAAGTTTTGGCCCGTCTGTCTGACACGACGAGTGATC
GTTATCGAATAAGATTATTCGAATCATCAAAGCTTCACAAGCTTGATTCTAGTGCGAGTAACTTTCGCACTGAACATGATTTCTTCATCGATGCATTCTT
CAAGCATCGATGGTACAGTGGGAATCACAAACGTGATGGTTCCTCTCTGATTCAGGCATGGAACGCTTTTATCCACAATGCTGGTGAGATTGAGCGTGAT
GCCTGTATAGACAAGCTATTGCTAGCTTGAAATTGTTTTGAGAAACGGACCTCTACCGGTGCACGTTTCAAACTGCATCGGTTGTCAAGAGAGGCCGGGC
TACCATGCCTCTCTTGGAGTGATGCGTGCCACTGTAGTGTGAACAACTTGACACGATCTCCAAAGGAAAGTCTACTCGATGAATGACCCCTGGTGGAGCG
TACGTGTCACTCAAGATATGTACGAGGGAATAGCTAATTTGCAGTCCCTCTACAAGCGCTCTGGGCGTTCGTTTCCCGATGGGCCTTCTTCGACATCGGA
TGCGCCTTGTCGTACTGCTCGACAAGGCCCAAAACATCAACCAGCAGTTGAGATCGAGGCTCCCAACTATCTACCGAGGGTGGATACCCGCGCCACTGGA
CGAGGTAACTCGTCCGACGTCCCTTCACATCGCGGTGGTTCAACAAGCGTCCCACGAGGAAGCGTTGGCCACCGCGCGCATCAATCAATGAATGAGGCGG
AGGAGGAAACACGTTCTCAGACGGTTTTGCAGGTTCAATCTGATACTGTGAGCCAGATCGAGCGCGTAAGGTGTGAGTTGCGCGAGGATATCGAGCACGA
GAGGAGCAGACGTTTGGGTCTGGTAGACCATGTGACATGTCTCTCCTCGGAACGGGAGAGAGATCGATCCGATTTTGCTTTTGCTCAGCTTGAGAACGAG
CGGACTCAGCGTTTTCTTCGCGACGAGCTAGTAGGAGCTCGTCAGGATATCTCTCAGCTTCGCGGGGAGATATCCGAATTTCAGACTCGGGCTGATAATC
AGCACCGCGAACACAAGTATCTCTTGGAGATGCTTGAGCGCAAGGGATTTCTTCACCGGAAGAAGTCCCGTACTGGTGATAAGGTCTAAGGCGACCGACG
TAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCGTGTATGCGTTGCCTATGTGGCGCAACACACGAAATGGACCGATTAACTTGGGTAGTA
ACTTGTTACTACCCACGTTAGTCACTATGTGTCAAGGTAAGTTTACCGTAGATAGTAAGACTAGGTCACCTTCGTTGAATGAAAGAACGTTTGTCCTTCC
ATTCTTGTCTGCGTTTTTTTGTCGGTCCACTGCTTTTGCAATGGAATCTTGCACAAAACGGACAACCGTTTCGCAAGACAGTGTGAATTCATCTGCTGAC
TCGCTGTCTTTGGCTATAGTGCGCTTGGAGCGCACTGTGGCAAGATCAGTGACCTGGGTAGTAAGAACATCTTCGCTCTTACTTTCCTCTTCTTCACCGA
AGTCGATGTGATCGAAATCGGCGTCATAAGTAGTGACATCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCGTTCGCTCGAATGATTCCCTCCCCC
TCAAACTATAGTTACACTCTAAGAAGGTTGGTAGGCGTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTATGCATCGCCGATGCATGCACCGAGTTGTT
GATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAAGGAATGGACGTAACCCCGAAGTATTTTCTCAAGAACGCGGTTTGCACGTTCTGTC
TGACCATCTGTTTCAGGATGGTCAGAGGTCGACATCTGAAGGCGCGTACCGAGTGTTTTGAACACGGATCGCCAGAATTCCTCAGTGGATCGTGGGTATC
TATCAGAGACGAGTTCACGAGGCAATCCATGCAGACGAAAGATCGCGTCAATAAAAACACAAGCACTTGCCGATGCATTGATTGATTCAGGTACAGCGAC
CACGTGTACCATTCTGCTGAATCTATCAACGAACACAAGAATTCCTGTATTCTTGTGTGGGTCTGCGAGGAATCCAAAGACAAAGTCTATTGAGACTGAT
TCCCAGCATTCTGCCGGAAAGGGCAAGGGTTGCAGCGGCGCACGAAGTGAAGGACCAGACTTCACTCGTTGACATATTTCTCATGCGCGGACGTACTTTC
GCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTC
ATACATGATGCGCAGTCGCAGGTTATCATGGTCTCGGTACGACGACACGAGGCGTGTCGCCGGCAACGGCTGTATACTTCAGTAAGCCATTGTGGACTGT
ATATCAATCCGTGGAGGATCGATATACTG