Description :
From Genome Similarity Track
Location :
Scaffold_2304:1861- 3083
Sequence
1222 bases(100 bases per row)
GTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTCATCCAGGGACCAGGTCGATCGCAATACCTCCAGGTC
ACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGCCGAGGGTTGGCGAAGGACGGTATCCTTAGGCGACCTGGATATGTGTCAG
TGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGG
TCCCTTGGTGGATCAGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGTCGGATTGAGGTCCAAGCGATGGAAGTTGGATCCAGGACGGGG
GACGATCCCCAGAATCGGCCCTCAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGG
ATCCTAGCTTTTCATGGGGCAGAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACTGTCCGATTTAAACTCGCTAGAGGCTCGACT
AGATCCAACTGGTGGCTTCCCCGATACCAGGGTACCTATACCCCCGAAGATTGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTG
GATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTAC
CACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGAAGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAG
CCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGACGACGCGAAACCGATCGCTCAGAGG
GTGCGGAAGGTGGCACCTCAGTTCCGGGAAAGACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCAT
CCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGAT
GCCTCTAATCAACGGTGGATAG