Description :
From Genome Similarity Track
Location :
Scaffold_2885:186- 4078
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2885-fgenesh-gene-0.1Di-N-acetylchitobiase
Pytar_ATCC12531maker-par_contig_2885-fgenesh-gene-0.0CG17669-PA

Sequence
3892 bases(100 bases per row)
CTCCATCGCGTGCCACATGCGACGCGCGCCGTCCGCATCACCCGCATAGTCGAGCGTGTCGGCGTTCCACATGCCGACGCCACGGATCCCAAGCGACTTG
ACCAGCGCGTACTTGAGTCGCAGACTCTGCTCGTCGTCAAACCAGAGCTGCGTGGCCACACCATTCTCTTCATACTGCAGGAACTGCGTTTGCGACATGG
CGTCCCAATGGCGCGCATCGCTCGGAAGCCGCTTGCGGATCTTTTCGATCTCGCCGTAGTCGATCTGTGATCCAGAGGCGTCGCTGCATGGCGCATCGAA
AAACGGCATCGGCTTGATCGCACAGAGCGATTGTGCGGCGCTGAAGGTCTTACATGTGTACTTGTAGCCATACCAGGGTACGCCCAGCACGAGCTTCTTT
GGGTCGATATGGTACGCAAAAAGAAACTCACGAAGCCCTTGCTCGACGAGCGCACGCGGCGAGTTCGCTGCCGCGAGACACTGGTAGTACACTTGGCTGC
GCATGTCATACTTTGGGAAATGCAGATAGAGGTCAGTGAAAAAGAACCTTCTTTCTTCAAGCCCATGAGCTAGAACGTACCGACATGACAAAGAAGAAGT
CGACAACTTCCGAGAGTTGTTTCCACTCGTAGAAGCGTCCATCGATGGGCCGTGGCGCCCACGGCACGTCAAAAGTGATCTGGGCCTTGGCGGTCAGTGG
GTGGCGCTTTAGCTCTGTGCGTAGCTCCTTGACGAGCTGCGTCTGACACGCAGCCAGTTCACCCATGAGCGGCTTCTCCGTGTCGATGTTTACGCCGTCG
GCATGGTTCGTGACGATGCTCTCGTAGGTCAACTGGATCCACTTGCGTCGAGAGGCGGCGTCGCACAGAGTCTGCGTCTCATCAAAGTTGTGCTTGACCA
CGACCTTGACACCTTTGCTGTGCGCGTGGCAGAGAAGCTCCTTGTCGACATTCCATGCGATCGTCGTCACGCGCTCCCAGTCGTATTGCTTCCAACGGTC
GTCCGTCGAGACGGAAAACGCAAAGACCTCTTTCTTCCCTGGCGTCGTCCGGGTCGTGAAGACCACAGGCAGGCACAGCGATCTCGTGGCGCACGGACAC
GCACGTAGCTGCTCGATTTCAAACGGCGAGAGCGCGAGTGGGAAGGACTCCTCAAGAAACACGCTTACAGAATCCGACACGCCAATGGTCACCGTGGCGG
CCAACAGTGCCGACGCGAGCGTTCGCATGTTCTTGCCTTCGCGATCTTTTCGTTCGATTTTTTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCAGTACACTTCCCTATAATTTTCAACCAATCAGCGCGTTCATCTCTCGCGTCGTTTCAGGATCGCAAGATTCAGAGGAACGGATCCCT
TCGAATAGCCATATTCCGTCAAGATCGACCTTCGCGACAACCATGGCACGCACAACGAACGCGCTTATGATGAGTCTGGGCACCGTCAACATGTGGGGCT
TCTCGCCAGCCTTCGACCTGTTGGAGGCAGTGGACGCGGCGAAGCAAGAGCAGAATCAAGCGGGCGAGCCGATCTCGATCTTGTTGATTGGACCCGGCGA
CATTCGCCACGTGATGGCGACGATCGCTTCCCGCCGGCGACATGCTACGGGCAGCCGAAGCATCTTGCGGCCGTTGCACATCTATGTGTACGAGAAGGCG
GTGGAGCCGCTCGCGCGCCACTTGTTGCTGCTGCAGATTGCGCAGGACTGGGAGCTGCCGCTGCGCCAGCGGTGCAACGTGTTCCTCGAGGTCTTTGGGA
ACGCGCTCGTGCAGCAGCGCACAACTGATTACATTCATGACAAGGCCAAGATGCTCATGGAGTTGATCCACTACGAGCGCGGCTGGCTCGCCGACCAAGT
GGACTTATCCCACCTCAAAATGAAGACCCGCGATGAGCTTGTCGAGACCATCCAGAGCTGGGCTCCGAGTGTACGCTTCGATAGTACGTACTGCATAACT
GCTTGTAGTATATGCTGCTGGTGTTGATGGTGACGGCTGTTTGGGCTTAGTGGAGACGCTACGCGACCATCGACTGCGCCACTACTACGAGACGCGGTAT
GACTACCGCGATAACCTCGTCGATTGGGACTACACGGTACAACCTCCGCTCCCTCTTGATCTTTTATCATCTCCTGGGCTAAAAGTTTCGTTGCCGTGAC
GGACAGATGACGTTGCGAAAGATTGAGAACGCGAGCGTGATCCACAGCAAGCAGTTCCGCACGTGGCGCAACACGGGCGTCGCGTTCGAGTTTGGTGACC
AGAGTTATACGGAACCGAATCGCTCACTGGCGGCCTACACGGAGGCCCACAAAAAGAACCACGGGTCAGTGCTGTGCCGTGGACTATGGACGGATATCGT
GGTCGGTCCGTACGTGTCGTTTGGCGTCCAGTGCGATGCGCCCAATAAGTTGGCCAAGCAGCTCTTTGAAGTCCACAACAAAGGCACGGGCGTCGAGCAG
AACCGCCATGTAGGGGATTTGTCGGCGTGTCCGCTATTGCACAATGTGGGAGGATTCACGGATCTTGTGGATTACAGAACACGACAGAGGTCGCGGTGTA
CAACGTGCTGTCGTATCTGTATGAGATGGAGACGGGCGATGTCTACAAAATGAAGAAAGCCCATGATGTGTACAGCGGCATCGGCGAGTTGGAGCTTGAC
ACTGGAAGCACCGGGAAACGGCAGCCGTCAACCAAAGAATTGCCGCGAATTGTGGAAGTGGAGACTGATGGCGATGAGGACCCCAAAGCCACGTCCAACC
AAGAGAACATTAAGAGGTACGACCTCCTTCTTCCCACTGAAATGCCTGGGCTCGATGATGCGACAGAGGATGCTTATGTGTATAGTAGTTCGATCCAGCA
AGAGGCACGCGAGCGTGATGCCCAGAAACGCGCCAGTATAATCGTTGAGTCGTTTGAAGGCGTGAAGGTGGGCTGGAGAAGTCATGCCTTGTGTCAATGT
AGCAACAAGCGAGTGATTGATGCCTCATTGTGTCTCAGATCATCCCGCTCACAGGAAAACTCGATGATCTGTACAAGAAAAAGCGATACGCGCGACTGTT
CGACCACGTCTTCCTCTCTTCACAACACTGCCACACGCTTCAGGTTGAATCCGATCAAGACATCATGGGCTTCACGGAGTTGCTGCGCGATGAAGCGGTT
GTGAGCGTCGAGTCCCCAATGTGAGATATTCACCGGACCGAGGATATACCACTCGGCCTTGTTGCTGACAATATTTGTGGACGTTGGTGTAGGTTTCTGT
TGCCGCTCACTGAAGACCAGCGGGTGTTGTATGTCAAGAAGCTGGTTGAGATGGCAGAAGCTCAAGCACTTGACCCCGTGTTCGCGTTTTCCAAGTCACC
ATCAAAGCAAGACCTGCAAAAGATCGAAAATGCCGTTCTGGGATTCAACTTCAAACGCCCAGAATGAAAACTATGAAAAACAGTACACGACGTGTACTGT
CTTTGGCGTGACGTGTAGTACGGCACTACACGTCACGCCGCTGCGTACCGATCCCGCGCAATCATACGTCTTTTGGCCTTCTTGGGAGTCTGATCGGAGT
TAAGCTGGTGGTCCTCGCTTTGATTAGCCATCTCTGACTCAATCAGTGCCGATGCTGGCAGAAGGACGACACGCTTTTGTGGCTGGTCCTGTGGACTCGA
CAGAGATATGCTGTCGCCACCGTAAAGGCTTCGGCATATAGCAGCAAAATCCCGCAAAACATCGAGGGCTTCGACCCGTGTTTGCTTGCAAAGGGGCCGC
CATTCGGTCGCGACGCAGCATGCCGGATACGTAAGCACCGAGTCACCGGAGAAGCGAATGCGGACGTATCCTCCGAAGCGTGCTGGTAGATC