Description :
From Genome Similarity Track
Location :
Scaffold_946:186- 3341
Sequence
3155 bases(100 bases per row)
AAACAAAGCCGTTCAGCGTCGTCAGCGATGCCTCCGACTAATCCATTGGGCATTGCATTGCTGCAGGCCAACACGGCTGGACATGTTCGAGTCATCTCGT
TCCAGTCCAGGCGGCTAAAAGTCGCCGAACGGAGCTACCCTGTCCACGACAAGGAACGCCTGGCAATGAAGTATGCCCTTGTGAAGGTTCGGGTTCATCT
TCTGGGCTCACGGCCCTTTGCGATCTACACAGACCACGCATCATTGAGGACGGCGACAAATTTGCCTCACTTTTCCCAACGAATGGTGAGGTGGCTGTCC
TTCTTCGCGCAGTACAGCTTTCGCGTGAGTACAACCCGGACAAGTTCAACGTGCTTGCGGATGCCCTCTCCCGGCGTCCCGACTACGAGTTGGCCCCCCG
CACACGGGTGACAACGGATCCATTTGATCGGATACGCATGGCGTATCGGGATCATGAGGCTGTCATGTCTATCGTCAAGTTTCTCGCGGCAGGAACGAAC
GCGAAGTCCGACTAGTTTTCGGCGCGACTCAAACGATATGAGCTGAAGGATGGCTTCCTCTATTACCGGGTGAGCCCAATTAACCTCCACGGGTGGTAGA
ACCCAGCGACGATGATCTGAAGCTCGACATCCTCGCGGAGGCGCCCGACACGCCCTCCAGTGGCCACTTAAGCCGCGACAAGACCTTCCTGTCAGTCTCT
CAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCACGTTACGCGAAGACATGCGAAACATGTCATCGGGTTAAGCCCGCAGGGCACGACTCGGCTT
CGCTACAGCGCCTGCCCGTTCTAGCTGACTGTTGGAAGTCGATGAGCCTTGACTTCAGCTTTGGGCTTCCTGCCGATGGACACGGCAGCACTGGGATTTT
GGTACTCGTGTGTCGGCTGAGCAAGATGGTGCATCTCGCTCCAGTACCCATTACCGCCACAAGTGAGAAGACCGCGAGGTTGCTCGTCGATGGCGTGTTC
CGCTATCACGGTCTCCCGGAGACAATTGTCTCAGACCTAGACCCGTGATTCATGGCTGCATTTTGGAAAATGCTGTTTCCTGTACTGGGAACTCGCCTAC
CGATGTCCTCTGCGGACCATTCACAATCAGATGGCCAGACAGAGCGCGCCAATAGAGTGCTCGAGGACACTCGGCACAGTGTGTGCGCGGAAGCCCCGCG
TACGAGGTCGACGCTGCTTCCAGCTGTTGGGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCTATCTATTTGAACGGCTTCCGTCAC
CCCTGAGTGTCTCTCACTCATCTAGGAGACATTGGTTCCTCTATTCTAAGTAGGAGAGGCTCGGAAAGCTTTTTCCTCCCAGGTCTCAGATATGAGACCG
GTTTCACGGCGAAAACAAGTGGAATTCTTGTGAATACCAAGCTATGCGTGATCATCAGGGTCCGCGATGAAATGGCAGTTGCCCCTGACAGACAGAAGGA
GTAATATGACAAACATGGGAGAGGAAACCTAACAGTACTGAAGGTGGGTAAGTTAGTGTTATAAGACACGAGGAACCTACCGCTAGACTACTGTCAGCTC
TGTCGGAAGCAACAAGCTGAAGCGCCGCTTCAATGGTCCATTAGCGGTCCTGGCCAGGCGTGGTGTGTCGTACACTATCGACCTGGGTAAGGCAATGACG
ACGCACCCGACGTTCTACGTTGGACGTCTGAAGCGGTACCATGATCCAGAGGAGGTTGCTGACTAGCAGACCACCTTCGTCCATCTCCTCGAACGAAGGC
CGGCAACAGATGTCGACGAAGGCGTCGGAGCCGGTGGCGGCACCCAAGCCTCGGGCTGAACGGCAAGGCTGCGGTCGAGACCGCACGCTGGAAGGGCCCC
GTACGAACGGACCCCAGAGCCATACGCCGAGTACGTCGAGTACGGGTTAGCACAATACGCGTACGACCAGGAGTGCGCCGAATAAGGCTCCGGGCGTGGC
AGCAGAGCCTCGATACGTCGGATCATGCGGAAGGCCTCGTCAAGATCGGACAAAGCGGCCCACTGGTCCACCCGCAGATGCAGGCTCGATACCTCATGCT
CCAACAAGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGTGGCAGCATCACCGCCAGTCCTGCAATCTTAAGCACGAGAACG
CGTTGACGAAGGCGGTCAACCTCTGGGCCCTGTGTCGGACCCGCCGGACAAGCACTCGAACGATAGTGGCGTTCCGGAGACGCCGAGTACCCGTACACGT
ACGAGGACACCGCCGCCCCTGCTTGACCGGAACGGAGAAGTTCACTACCTCGTGGGGCGGATTTCTCGAAGCAACGGCGTCACGGTAAGCGACAGCTCCT
CGTGAAGTGGAGGGGTTATGCCTACTCCGAGAACTCCTGGAAGCCAAATGAGCGACTCCCAATTGACCGCCCGAAGGCTGTCGTAATCTGGGAACAGAAG
CGGCTGCAGCTTCATAGGTAGTCCGGGCTTTTTTGCCCGAATGTGGAACGGACGTTGACGACACTCCGTACCCGCGCTCATTATGAGCGGTAAAAGTCGC
GCGCTTCAGTTGACAGTATGCGCTTGCTGACCAAATGGGCGAACCGGACACGAATATCACGCGGGTTCAGGATGCGGGACAGCAGCCGATCTTCATGGGG
TTCCCGTAACTCCGAGGGTGATTACTTTAGAGACTCCACACAGGCCCAGAGCATGTCCTCACACGAGTTCCAGTTGGGACAGTTCCCGAAAAGAACCCAG
GGGTAGCCCCAGAGAGGGGAGAGACCACACCGGCTCTCGGGCTTCTTACACTAAGTCGTGAAGGACTTTAAAAGGATTCGGTGAGGCGCGAGAAGCACGC
ACCAGGCCGCCTCCAAGTTGTCGACGAAAACTGCTCCTTCTGGACCAGGGTACGTTCGTAAACGCCCTTAGAAGTGTGGCCACCGACAAGGCCACGAGGA
GAGACGAGGATCTCCAGGGAAAGGTCAGCCCCAGAGCTCTCCTCGTGAGGCCAATAACCCGTTGAGTTGACGTTTGCTCCCTGGCTGACGGGTGCCATCA
CCGGACCCCCACGCGAGCTCCGGGCAGCTTGCAAGTCCTCCTGCTTCTAGTCGAG