Description :
From Genome Similarity Track
Location :
Scaffold_2811:186- 2750
Sequence
2564 bases(100 bases per row)
CTCCTCCGACCAAGGCCGGTGGAAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAAGGCATCTGGTGTCCACTTGGAACCGTTGCC
AGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGACCACCTCAAGGCTGGAGAGATTGCTGAGATGGAACTAATGAGACCT
GAGACCACTCCGGAGGAGCTAAACTCCTCCTCTGTTTTGGACGAGAGCGTCCTGGAAGACCTGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTC
TTAAGAACCCCAAGGATCCGGTGTATCCTTTGATGAAGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGTGTACG
GCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCG
AAAGCAAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCGGACTTTCTGCGTTCGTAAGCCGAACGGAGAGTGGCGTCTGGTTCACGCTT
ATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAGCAACATGGCCGGAAGCGTACTGTACAGTGCGCT
GGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTC
ATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGAGTACCTTCGTACAGACGTACTTCGACGACA
TATTCGTCCATAGCCGTGCCGAAGGGAGGCAAGACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATACGAGCGAACAAGCTCT
ACGCCAACATCGACAAGTGCGTTTTTCGCGTCACCAGAGATTAAGCTCTCGGGTGGCTTCGTAAGCAACGTGTGCGTTCGGGCTGACCCTGACAAGGTCA
AAGGCCATAGCAGCATTGCCGACGCCCCGATCCCAGAAGGTTTTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTTCACAAGTACAGCGGAGGGTACGCG
GGCTTCGCTAAGCCCTTGTCGATCCTATAGAAGGACGTCGACTGGCGCTGGGAGCAGGAGCACCAGGATGCTTTTGCCAGCATCAAGGCCAGTCTCCAAG
AGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTTCGATTACGCCATCGGATGTGCATTGCTACAGGCCGACAC
GGCTGGACACGAACGAGTCATCTCGTTCCAGTCTAGGCAGCTGAAAGCTGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTAGCAATGAAATAT
GCCTTTGTGAAGTTTCGTGTTCTCCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGTGTCCTTGAGGACGGCGACTTACTCGCCTCACCTCT
CCTAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCG
GCGTCCTGACTATGAGTTGGTCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACCCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATC
GTCAAGCTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCTCCTCTA
TTACCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCATGACGCGCCCTCCAGC
GGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCAGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTTAAGACATGCGAAA
CATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTT
TGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTTTAGTTCCGGTCACTGTTACG
GGCGAACAAACCGCAGGGTTGCTCGTTGATGGCGTGTTCCGCTATCACGGCCTCCCGGAGACGATTGTCTCGGACCGGAGACCCGCGGCTCACTACTGCG
TTTTGGAAAAACGCTGTTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGGCCATCCGCAGACAGACGGCCAAACAGAGCGCGCCAATCGAGT
GCTCGAGGACACTCGCGCAGTGTTTAGGTGTGAAAACACGTGCCATGTCCTCCCGGCCTGTAGT