Description :
From Genome Similarity Track
Location :
Scaffold_1061:186- 1394
Transcript NameFunction/comments
Phyke_g11758conserved hypothetical protein

Sequence
1208 bases(100 bases per row)
CACACATGGCAAGATGATAAATGTCGTGCGAGATAGGCGTTGAGCTAGAGAGTTTGGCTGCTAATGTTCGCATGGcaaaccacttcaactttgtTGATAT
GCAGCTACTGGCAACCGTGAAACTTGATCACCTTGCCGTCTAGACGAACAACATGTGGGATCCTCCTGACTCATTCTCACTCCATACATGACTACATTGC
AGTCACTGCGATGACTAGAAATCTGCATCGTGCTTCTCTTAACAGTGTGTGTTCCGATACCGCTGACTTTATTTAATCCAATCAGATCTCTCCATTTAGT
TCTTCACGCGTTTTGATTGGCTCTGCTGCATCGTAGATTTTTGTGGTCAAGACATTTGCCATGCTGCGACTCCCTTACGTGGTGAGGTCTCCTCGACCTC
TCCTAGCGTATGCTCGGGGGTTCACAGCTACTGGCAACCCCGTTAAGACGTCGGacaatgcagcagccacccGACGGCGGGAAGCCATCTACTATGCTCG
AATCTCACGGAAATTCCCGGCGTATTTCGGCTCCCAACTGTCGATGGCAGGTCTGGACCGGACCATTCGCTTCTTTGAGGACCGAGGGGTCGACAAGACG
TCAGCATTGCGAGTAATCGCCTGCCATGTATCCGTGAGTTAGCGACAGAATATTGCAGTCTAATTATTGCAATGCAGAGTATTCATTTTCTTGGATTGAC
AGCTGACTCACTATACGCTCAGCACGATGGAGAGCAAGGTATGTGTGCGGGGTTTGAATAGCTGTAGGGGAATGTTAACATTAACAATATCTAACGGGAT
TATTCGGACACCACTTGTTATGCCGGCTGCAGATTGCTTGGCTGAGTGATTTGGGGCTCAGTCAGGACAAAATTAATATCACAATTCTGAGGCACCCAAA
CATCCTCGGCATCTCTTTTGAAAAACTGGACGCATTAAAGCAATGGTACATCAAGCATGGCGTGTCGGAGGATAAGGTGAGTGAGCTTGATACTATTAAT
TGCGAGGAAGAGCTGATTTGACAGAGTGGATCTGCATGTCACAACAATTTGTCTAGCTCCCGTACTTGTTCAATGTCTTTCCACAAGCGGCATCATCCAG
CATTGAGGCCAACTTGGATCCGAAAGTGGACCTTCTTAGGAGAAATGGATTCAGCAAGAACCAGATCACACGAGCTCTGTCGCTGACACCTCAATTTTTC
ACGCACAg