Description :
From Genome Similarity Track
Location :
contig_47:18595- 21036
Transcript NameFunction/comments
g9608.t1hypothetical protein

Sequence
2441 bases(100 bases per row)
CTCGACCCATCGAGCAACAAAAGCGTCTCCAGTGAGGAATTTCGCGAGTATGTGGCATCCACACCGACCCTGCATCAATTTCTAACGCTCTTTGCAGGCG
AAGAGCTGCGCAATCCCCTTACGTTTGAGCCTAGCGCTGCACACTTTTCACGGCAAACGGAGCTGTACGAGACGCTATTGTGTAGGTACGTGACGTTCGA
GGGCCGCCAAGAGCGTCGCCGAGATAGTGCTGCGCTCTTGATCCAGTCCACCTGGAGACGCCGTTGCTCTGTTTCAGATGCCCAGCGACGTGCACACGAC
CGAGTCGTGCACCGACACAAATCGGCGGCTCAACTGCAAGGATTTTTCAAGAACCGACGCGTTGCTCGAGAGCTTGAGGCTCGTGCAGAGGTTGAGCGAG
CTGCTCTCAATGGAGGGGTGTTCGCTGCTGGTTCTGGTCCTTGTACGGGCATCACAATGACAGATATTCGTCAAGAGAAGACGAGGGTTTTACTGCTGGA
GCTCCTGTTCGGCTCATCGGAGCTTTTGTGAACCTCAATGCGAAGCTCACGACGCTCTCTGCTTCATCCACCTTCGCACTGGGCGTCCAAGACGATGGTC
ACTCGATATTTGCCTGGGGGCGATGTCTTCCCCGCCTTTATGCCGACCAGCCTGGCGAAGATGTCGATAACGAGAGTAAAGTTTGTCTGACGCACCCAAC
ACCGCGTCGACTGCAAGCTCAATTGTCAGATCCGGTTATTCAAGTGGCTTGCGGCTTAAGACATGCCCTTGTACTCACGCAAAATGGTATGCTATTTTCT
TGGGGCTTCAATGATCACGGGCAACTCGGTCACGGCTCGGCAGAGACAATAGCGGCTCGTACCTCAGGTCGAGTCCGCTACGCGTCCTACTACGACGAAC
GATCCGGAGAAGACGAGGACTATCTGGCATCTCCGACAAGACTCCTTTATTTTGAAGGCTCTGCAGCGCAGCAAGCAGGCCCCATTCCTGTAGCGCAAGT
GTGTTGCGGGAAATATTACTGCATGGCGTTGAGTCAAGCGGGAGATGTCTTCACCTGGGGTGAGGCGTCTGAAGGTCAACTTGGCCACGGCGAGATGCAT
GAATTCTACCAAGTTGCACTCGCTGATCGGCACATGGTCAGCTCGGCGTACACGTACTTGGCACAGCCCGAGCCGGTGCTGGCACTGTGCGACGTTCGAG
TGACGCAAATTGCATGTCGAGGAAACCACTCCGTCGCTCTGAGTGCCGATCACGCGAACGCTAGGCTTTTTGAGTGGGGTAACTGGGGCAGACGGCGTGG
TGTGGACAGCGAGCACGCCTTCGTGCCTGAAGAAATGGCCGGAGCTTCCGCTCTGCGTCTCCGTCAGGTTGCAGTCGGAGATCACCACATATTAGCGGAA
GGAGCAAGTGTATGGCTTAAGCTGGTAACGCGCACGAATGGACCGGTCCAAGCTGCTGAGCACGGAGAGGAAGAGACGGGATTCTTTGTGGAGCCACTGG
CTGGTGCATCGAGCTCACTTGATGCTATCGAGCACGATTTCATGGGAGAAATCTCAACTTCGTGGGTCTGCTACCTTGTTGACCTGGACGCCGATGACGT
TGACGAAGTCGAGAGTGCGAATAACGCTACCGATGAGCCATCGTCTCGACCTAGCACAGGCAAAGTCGATGGAGCACTTTGGCAACGGCGAGCGGAGCGA
TTCGCTGTTAGCCTTGACCGACTGGCAGAATTCGACCCTCGTTCACTGCGTCTGCTGGTCAGTGCACCCGGAAGTGCAACCGATGCTATCAACACCTACG
CACAGGGAGTGGATCAGTGCTTACGTGGTCGCGTGGCAAACCGTCTTGTAGTCATGCCTCGAGGTAAATCCGCCGGGTTCTACGTGCAGTTCCGCCTTCC
TTTAGCTACGTCTAACAGTGCAGCGCTTGGACCGGAGACAAACAATGGGGACGCTCGAGCCGAGGAACCTGGTGATGATGATGATCCTAATAGCAGTGCT
GCAGCTTCCGGTGTAGTGCTCGAGCTTGCAGTTTGTGGGTCTAACACCGCGAAGCAAGCAATCAGCCGACGCGGATTTGTTACACACGTATTTCATCCGG
CCATGGAGGCCGCGGCCAAGCGGCTTAAGCAGCAACAACTTCGTGCACGTTCAGTAACGAAGAAAAGCCCACGGTCGCACCCACGGAGATGAACAGCATT
TTTGTGTTAGAGATTGATCAGAGTGTGCTTGCACCACTAGCTTCAGCCGTGACTGAGAACGATCCAAGCGCTTCACAAGAGCCCAGTGCTCTTGGAACTG
AAAGCGAGGCGGAGCTTGAAGCGGAGACGATTATAAGCGAGATTGGACATCGTGTACTGGAGCTCCAAGAAGCAGGTGCTCTTGTTGTACTTGTTGTGCT
TGATCTGTTTGAAGCAGAAGCATTCGCGCTGCAGTTTTCGG