Description :
From Genome Similarity Track
Location :
Scaffold_514:18595- 20607
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_514-snap-gene-0.6Myosin
Pytir_DAOMBR486maker-pir_contig_514-snap-gene-0.7Myosin

Sequence
2012 bases(100 bases per row)
CAAGAGCAGTACCTGGAGAAGGACCGCAGCGAGCTCCCGCCGCACGTGTACGCCACGAGCGCGGGCAGCTACCAGCACATGCGCACGTTTGGCGAGGACC
AGAGTATCCTCGTGAGTGGTGAGTCCGGCGCCGGTAAGACTGAGACGACCAAGATCCTCATGTCCCACTTGGCGGCGGCCGGCAACAACGACGTCGCCAA
CGGCGTAAGCAGTGAGAAGGAGACGAGCATCATCGAGCGCGTGTTGGACGCCAACCCGCTCATGGAGTCGTTTGGTAACGCGAAGACGTCGCGCAATGAC
AACAGTTCGCGCTTCGGTAAGTTCTCGGAGCTGCAGTTCAACAACCTCGGCCAGCTCATCGGCGCCAAATCGCGCACGTACTTGCTCGAGAAGTCGCGCG
TGTCGCTCCAGGGCCAGGACGAGCGCAACTACCACATTTTCTACCAGNNNNNNNNNNGCTCGCGGCGCCAGAGGAGATGACAACGCAGATCGAGCTCGCG
GGCATGAAGGCCGAGGATTTCCCATTTGTGGACGCGAAAGGACAATCGGTGAGTGAAGGTATGAAGGACGCGCAGCGGTTCAAGCAGACCGTGTCGTGTC
TCGAGACCATGGGCGTGTCGTTGGACGACCAGCTGAGCATTTTCAAGGTCGTCGCGGCGATCCTGCACCTGTCGCGTTTGCAATTCGCGTCCACGCAGGG
TAACGAAGACGCGTCCGAGCTCGTGAACGACCCGGCGAACTTGCGCGCGAAGGAGGTCGTATCGAAGCTGCTTGACTTCTCGGAGGAGGAGCTCGAGAAG
GCGCTCGTGACGCGCCAGATGTCGCTCTCTGCGGTCGAGACGTACCAAGTGCCGCTGAACGTGTCACAGGCGCAGGGTGCGCGCACGGCGCTGGGCGTCG
CGCTCTACTCGCACCTGTTTGGCTGGTTGACCCACCGCGTAAACATGTCGACGAGCGCGCCCGCTGCGGACGTCGCGAACAAGATCTGCATCTTGGATAT
CTTTGGGTTCGAGATCTTTGAGAAGAACTCGTTCGAGCAGCTCTGCATCAACTACGCGAACGAGAAGCTGCAGCAGAAGTTCACGCAGGACGTGTTCAAG
TCGATCCAGGTCGAGTACGAGGAAGAGGGAATCCCATGGACGCGCATTGAATTTGCGGATAATGCGAACGTACTGGCGTTGATTGAAGGTCGCTTTGGTG
TGCTCTCGTTGCTGAACGAAGAGTGCATGCGACCAAAGGGCAGCGACGACGCGTTTGCGAACAAGCTCAAGGCGCACTACAACGACAATGACCGCTTCGA
GAGCCCTCGCTTTGCGCGCGACGCGTTCGTGATCAAGCACTACGCCGGTCCGGTGCAGTACGACACGAAGGGTTTCTTGCTCAAGAACACGGACGCGCTG
CAGAACGACCTGATCGTGCTCATCCGCAAGAGCCAGTCACCGTTTGTCAAGGCGCTGTTCCCGGAGGAGCACGTCGGCGATGCAATGACGGGCATCCAGG
GCCGTCCCGCGGGCGGTGCTGCTGGTGGCGCCGGTGGGCGTCCGCAGCTCAAGCGCCGCACGTCGATCATCTCGGATACGGTCGGCACGCAGTTCAAGAG
CCAGCTGAACGGGCTCATGGAGGATATTCGCCGCACGAACGTGCACTACATCCGTTGTATTAAGCCGAACGGCCAGAAGAGCCCGAGCGTATTCAACAAG
CTCCGCGTGACCGAGCAGCTGCAGTGCGCCGGTGTGGTCGAAGCCGTGCGCATCAGTCGCATGGCGTACCCGAACCGTCTGCTGCAGACCGTGTTCCTGG
AGCGCTTCCGCGGCGTGGCGTCGACCACCAAGTCAGCGCACGCGATCGAGGATGTGGCGCAGGACGCGAACCAGTCGGACGAGGCCAAGACTGTCAACGC
GGTGCGTGACTTGCTCGCGAACCACTTGCTGCCGGGCAAGGAGAAAGAGTACCAGATCGGTAAGACCCGCGTGTTCTTCCGCAAGGGCGCGCTCGAGTCG
CTCGAGGAGATG