Description :
From Genome Similarity Track
Location :
Scaffold_34:185947- 187092
Transcript NameFunction/comments
Physo_134810hypothetical protein

Sequence
1145 bases(100 bases per row)
CAAAACGGGCAAGGCTGCCTCGCGCGGTTTCCTCATGATGATCCTTGGCCTGTTGTGGTGTGCCCCAGCACGGCAACTCTCTGAAGGTTTGTATTGATGC
CCACACTAGGAGCTTGCGGCGAGGGCTTATCGACGTGTTGACTCACGGTTTTTTATTTATGAATTGCAGACGAGTTGTGGAAACAGCTAATCCGCCTGGA
CTCGAAAGTGAAACTGAAAGGTGAGCACCCACAACTGGGTGACATCCCGCTACTTTTCAAGACATTCGAGGCCCAGCTGTAAGTGAATCGATCTCGCATA
ACCTCCAGAGTAAGTTTAACGTCCTGGTACTCATGCCGTTTGCCTTTTTGGTACATTCAGTTACCTGGACGCGACGTCAGAGCTCGATGCCGACTTGAAG
AAGATCAAGTATTATCAGTATGGCCCTCGTACGCTCATGGAAGTGGGCAAGGTGCAGATTCTCAACTTTGTCTGCAAGGTGCGAGCTTTCTTCTGCTCCA
TGCCATGCGTTTGCGACTATTAATTAATAATCCGCCTGATGCGTTTTGTCATGCAGTTGATCACGGGGCGTCCTCCTTCGGATGTGCAGGTTAACGAGGT
CTTGTCGGAGGACAGCTAGGTTGCTGGCCGAAGCAATTTTACACTAGCAGCAGCAGCAGCCAATTTACGGTGCCAAACTTCATTTTCAATCCCCGTCTTT
GTTCCTGACTTACCTGAGCTGCCATCCGTTCAAAATGGAGTCCATCGTTGCCGCATACGGATCTTCATCCGAAGCATCCGACGATGCTGCTTCAGTATCG
TCGGAAGATGAAGTGGAGGAAAGCACATCCGTTGAGCTTAGCGCCGAGGTAGCTACGCAGATCGGTACCAAGCGCAAGCGCCCCGACGAGCCCCAGTGGA
AACGAGCGTTCCCGCACGTAGATGGGAATTGGCCAAGCCATGTACGCATCGACATTCCGGTCACCGAAGAGCTACGTGAGATGGCCAAATGCGCTATTGA
CCGTGCCCAGGAGCTCGTGGGTGAGAATGTGACACTGGTTCCATTTGAGGAGCTCAGGCTCGGCGAGTCTTCATCGACAGGCAGTGGCGGTGGACTGCAC
TTGAGTCTTTCGCGGGCCTTTATCCTCACGTATGACCAGATCGAA