Description :
From Genome Similarity Track
Location :
Scaffold_13:185916- 187044
Sequence
1128 bases(100 bases per row)
TGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTCACCTTCATTGAATAAAGAACATTTGCCCTTCCATTCTTTTCTGCGTTTTTCTTTTGTCGGTC
CACTGCTTCTGCAATGGAATCTTGCACGAAACGGACAACCGCTTCGCAAGCCAGTATGAATTCATCTGCGGACTCGCTGTCTTAAGCTATAGTGCGCTTG
GAGCGCACTGCGGCGAGATCAGTGACCTGGGTAGTAAGAACACCCTCTTACTACCCAGGTCACTTAACCGAAGTCGATGTGATCGACATCGGCGTCATAC
GTAGTGAACTCGTGGTCAGTACTTGATGAGTGAGAGCCGAGTTGGCGTTCGCTCGAATGATTCCCTCCCCCTCAAACTAGAGTTACACTCTAAAAAGGTG
GGTAGGCGTGGGTGGCACAAGTCATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGACGAATTCCACCATTGGCAAGAATT
CGCAAACGAATGGACATAACCCCGAAGGATTTCCTCAAGAACGCGGTTTGCACGTTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGA
AGGCGCGTTCCGAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGGATCGTGGGTCTCGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAA
ATATCGTGTCAATAAAGACACGAGCACATGCCGATGCATTGATAAATTCAGGTACAGCGACCAGGTGTACCATTTTACAAAATCTATTAACTAACACAAG
AATACCTGCATTCTTGTGTGGGTCTGCGAAGAACCCATAGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAAAGGGCAAGGGTTGCAACGGC
GCACGAAGTGAAGGACCAGACTTCACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCGCACAAACTGATACTGGCGGGGCCAGTAAAAGTCGCGAC
TAACTTTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTCATACATGATGCGCAGTCGCATGTCACCATGGTCCCGGTA
CGATTACACGAGGCGTGTCGCCGGCAAC