Description :
From Genome Similarity Track
Location :
Scaffold_125:18591- 22340
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_125-snap-gene-0.21Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_125-snap-gene-0.22Protein phosphatase 2C

Sequence
3749 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCTGGACGAaGCTCGTGaCGACATCCATCAGCCCCAATCTC
GCACCCTCCGTCCGCTGCACTTCCcTCCcATTCGCGCACCTGAATGGcgACGCcAACCcTGTCTCCGAGCTGGACGCGATGGTTCcTCCCAAGATGCGcT
CCGGTCAGTTCGTCGACcGACAGTCAAGCACCACGTGTGGAATGGcGCACGCACGATGGACGAGGTATGTATGGGGTCTGTCGCTCTCTCTCTTGTGCTG
ACTGCTGaCTGCTGACTGCTGGATATGCTTCTGCTtCTGTAGACTGtcACCGTCTTGACGTGCCACATCAAACGCGAGAACGCGTTCCGCTCGACGCGCG
TGAAGCAGATGCTGGGCGACGCCAACATTCCGTTCCgtgaGaTCgacgtgtcGTATGAACACCACGAGGTCGTGCGCGTGGCGTACATGGCCgTCAGTGG
CGAGACGGATCTGCCACAGGTCTTCCGACAGAGCTCGTCGGGcgACTCGATCGAGTTTATTGGCGGTCACGATGCcATCATGGTATGTGCGCTTGGGAGC
TACCTATGCTCGTGATATTTTTgTGGCGTCACTCATATCGTGTGTGgTTGACGTTGTAGTACcTGCACGAtCTCGAGGGTATCCCGGACCACGTGATGGC
CAAGTGgAaCATTGAGAACCTCACGATGCGCTTACAGGGTGCGTTGACTCTGTGATGTATCGAGCATGGCTGCATACTAATGGCTGGTGTGGTGGATACA
GGTGTGAGTAAGCCCCGTTcAATGATGCAGGAGTGGGAAGACGctGAaGTgCAGAAGCTCCTCCGATTCCGCAAGGACATCTTCGACAAGCCCATCGACG
TGCACACCAAGATCTTCgcGCCCAGCGCCGCGCTGTCGGATCGCAACGCCAAGTGGACGGACGAGAGTAAGGAGGAAGGCGGCAGCGTCGATGTCGAGTG
GAGCAAGGAACGTGAGgTGCAACTCCGCCGCAAGTACTCGGATGTGCCCATGGCCATCGACGCCATGATCGAGTTCTCCCTCAACACCCTGACGAAGCGC
GATTCACGATTCCGCAATGGCAGGTGGAGCCTTGCCTTCGATATCACCGTCCCAGACATCGTCTACAAagACTGGGCTCCTGCCGACGGTCCGATTTGGA
TAGATTATAGCACACTACGTGCGTAGAGCTCCTTACGATTGGTAGGAAGACTCTCTAGCTATTAGACTAATGCACACTTTGCCCTGCATGGTCGAGCTCA
GGTCTGTAGGTTCTGTCCATTGACGGCGACTCAACTTGAGTCTCAAGTGATGCTGTTGTGTGACGTACTGAtCTAGGTGTATCCAAaTAAACGAACGTtG
GTTACTTCGGTGGTTCATTACGTGTCCCTTTGGGTGAGTGAGTTTGTCTGGGTGTCAAGAGGACGCgaTGGCGCGGCGTGGGGCAGCAGCTGAGAGCAAG
CGGCGCGTGGCGACGCAGCCGCCCCAGGGCTCAGACGCCGCCGACACGACTGCCGGAGAGAGAGGACCAATGTCTGCGCCTTATGTGCAGAGGCTGGGGC
TCTCGCAGCGCTGCTGCGGCGTCTCCGCCCTCACGCGCTCGCCCATCGACCTGTCCgCAGTgTTGGgCGATCGAGACGCGCTCCAAGCGATGGCGGATGA
GCtGTTCAGGCCATTCCGCCAGTCGCGTGTAGACATGGTTGTGGGAGTACTGGAGGATGACGGAGTTgAaGGAGGGgAAGGGAACACTGGTGCGCATGTG
TTCACTGCGGCTGTTGCAGGAGCtATGGCCGGTCGCCATTCCCTTGGTATGAAGGACAACAAACTCCCAGTACTTTGAGGGAGCATACTGACCGTGCCGT
GTATGCAGCATTAGGCCAGATGAGTGTCCAACGTAGACAGGAGTGCCAGCGAATCACCGCACCCCcGAGACAGGTGCGAACACGCTCAAAGAAGCGAGGA
CGCCTGACGGCGAGGGCACCAGAAGCCACCACAGAGGAGCCTgaGGACCAGAACGTCAGTTGCACACGCATCTCACACGTCGCGCTTGACAATAAGAAAC
TCCATATCGAGTTCCGACGCGATATACTCACCAACGCAGCGCCTGGGACGCGAATTGTGCTTGTAAGTGATTGGATCGAaCACGAGGACGCGTTCCTGGC
AGCCCGCGATGTGCTCACCTCGGAAGGACATGAAGTCGTTGGTGTGAGCTGTGTGGTTGCGACCAGCAGATCCGTGCGAGAGCGATTCGACACTCGCCAG
ATCCCGTTCTGCTGCTCTTGGGCgCCCTcAAGCGATGCTCAAGtCACGTTACGAGGACCCGCCGACCAAAACGTGCCCCAGTGTCAGTGCAGCACCAGCA
AATCTGAAGACAGCGCACAtACGAGTCCGTCGAAGAAGCGCAGGCGTCCAACTGAGGATCAGGTTGCCTTCCACCACTGCACGAGTCACCACGAAGCCAA
CTCACCtaGCGAAGACAGGAGTGTAAaTGCGACCAAGCcgTCAGACTCAGGTATACCTGCTGTTGCCGTATCCTtGTGAAGTAGTATGACTCAGAGCGTG
TCATGTCGCTTAGATGTGCGTCTTTACGCAGTATTTGATGGGCATGGCGGCTCCGTCGCTGTTGAGTAAGTGCGTGCTaTTTCAGCCACACCAACTGAAT
CTAACCTTCGCTCCTAAAcAGGCACGTGAAGAAACACCTTTGCATGGAAATCTTTAAGCGAGTATCGTCAGATTCCACCGAAGAACAGGTCGTAAAGGCT
CTGGAAGATGCATTTTtGGCATGTGATTtCTCTTTGAAGTCATATCTGGAGTCCCTCTCCTCGGAAGTCAGGACGTCGAAGGGATTTTGCAATACTGGAT
CATGTGCAGTCGTCGCATTGATTGTCAACTCTAGTCTTTACGTCGCCAATGTAGGCGACTGCACTGCGGTGATCGGCCGTAGAAACCCGATCACGGGTGA
TGTGTGGGCTCGCGAGCTATCCGTTGAGCACAACTGCCATAACCAGAGTGAAGTGAAACTCGTGATGCAACGCTCACGCGATCGCAACGCAATTCGTCTA
AGCAAAGACGACCAAGTCACAGAGAATGCATTCGGTGTGAAAAGAGTTGCCGGCAGTCTCGCTGTTACGAGGGCGTTTGGAGACTTTTACCTCAAATGCG
AAGAGTTCAGCTCTGCTCCATTCAAGGTaTGTGCGGAAATGCACTCTGTCACTGAAAGTACCTGACGGTTTGTGTGCAGAGCAAAGTCCCGTAcATTACT
GCCCAGCCAAGTGTCTCCGTCTATGACCTCCACGATGATGATGGGGCTCATGAGCAGTTCCTGATTTTGGCAAGTGATGGTCTATCGGAAGtcGTTGGGT
CAGAAGAAGCAGTCAAATTGgCGACGTCTTTTGGTACGTGCTCGAAGTC