Description :
From Genome Similarity Track
Location :
Scaffold_23:18580- 19975
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_23-abinit-gene-0.84Phospholipase D, Pi-PXTM-PLD

Sequence
1395 bases(100 bases per row)
GGATAATGACTCTACTACGCATGATCCGATCTCTGAGTGGACGTGGCTTCGGATCAAGAACATCTCTAGCCGCAACACTGCGATCTTCGAGTCTGTATTC
GACTGTGCACCCTCAAACCGTATGACTGCCTTCACCAGTTTCAGAAGTATCGAAGTAAACCAGATCTTCGAGAACCAGCGAATGAACGTTCTTAAGGGTC
CAGGCCGTCACGTGTGGGACAAAGAGAACCTCAAGGATGGTGACTATTCTCCATGGACAGATGTGAATGGTGTCCCAATCAATCTGGACAAGGTCAACCT
GAACGACTtCGTGGTGGATCGTTACAAGGATAAGAAGCGCAAGCATCTTTTCCTCATGGACCATGATGGTTGGTGCTACGCTCGTAATTTcTCCGTGTTC
CAAGAAGTGCGCATGCACAACTTCCGCAAACGTGACCGAATTCAGCACTTCATGACTGACAGACTCATGGCTCAAGTGCGACGCCGGCGATGGGTTCGCA
AGGACTCGGGGCTCATTCCATCAGAGGCTCTTCTCCGTAACAGTTCCTTCTCAGAAAGCGACGATGACGAGCAGAGTCGCTGGGCGTCTCTGTGGCGTCG
AATCCATCGTTCTGACTCAGCGACCAGCATGTCACGCGCCAACTCATTCACGAACGGCCGCCGAGCTGGTCAGTCGCTTACATCCTCGATGGTCCTCGCT
GACAACTCGTATCCGGAATCACCGGCAATATCGGTGTTCCGCcGCGGGCCACCAAACTCGCCACTTCGTGCACGCAGTGAGGATCACTATGGTGGAGGGA
ATGGCTTGAACGCCCGAGACTCAAGCATGTGGCCGCCAAACAACACTCGATCGAGCACTcTtGGAGTTGTTGGATCTCATCATCAGCATAACCAACAACA
CCAGAACCGAGACTCCGACGGTGGATTGAGACAAAGCACTGACTCAATGAAGGGaGGCATTGGTGTGTCACTGAAGAAaTGGGCATCGTTCATGGATACA
CCGATCGACCTTGGACGCCGCTCGCGTTTtACTGAGGAATATTTCTCGAAAGACAAAGATGAGGAAGTCtATGGCCAGACTTACACGAACGATGAGCACG
CGATGGAGTCGGGGCGATACAGTTCCAGAAGTCTACGGAGTGTGGACGGAGGATTCGCAACGACTGGCGGTGGAGTGAGCACCGACGCGGGTGGAGTCGG
AAAGCGAAGCATGGACATTGCGGCTGGTGACTGTCAGATCGGTCATCTCCAGACAGCAGCGACGGTGCGCAAGGAAGATGAGTCGCGAGCACGAGGTCAG
TTATCGGAGATCCGCGGTCATCTAGTCGACTTTCCAATCGACTTCCTGCGCGAGGAGATCTTGCAGCCAGCGATCCTGCCACACGATCTCCATAT