Description :
From Genome Similarity Track
Location :
Scaffold_356:18574- 23668
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_356-abinit-gene-0.33MtN3
Pytve_DAOMBR484maker-pve_contig_356-fgenesh-gene-0.3FKBP-type peptidyl-prolyl cis-trans isomerase
Pytve_DAOMBR484maker-pve_contig_356-snap-gene-0.24Conserved gene of unknown function
Pytve_DAOMBR484snap_masked-pve_contig_356-abinit-gene-0.37Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_356-snap-gene-0.18Mediator of RNA polymerase II transcription subunit
Pytve_DAOMBR484maker-pve_contig_356-fgenesh-gene-0.11Late embryogenesis abundant 1

Sequence
5094 bases(100 bases per row)
GCTCAGTTTTGAACACGTTGCCCCAAGAAGCTGCAGAGGTCGCATTCGTTGCTCCGCTGTGTGCACCATGTCGCTCGAGAACGCGCTGTACATGTCGTCG
TTCCTGGCGCGCAAGGCGGTTCCCGCGCTGGCCATCGGCTCGTCCATCGTCTTCGCCATCTCCCCCTGGTACGGTCTGCTTGAACGCATTGTTGTCGCGA
TGGCAGACTGATCCGACCGTTGGAGCGCAATTGCAGGCCAACGGTGTCGACGATCCTGCGCGCGCGCAGCACGCTCCAGTTCGCGTTCGCGCCGTTCTTC
TTCTACTTTGTGCAGTCCGTCATCTACACGCTGTACGGGTACACGACGGGCAACCAGGTCGTGTTCGGCACGTCGTTCCTCGGCGTCGTGCTCGGCGGCT
ACTACGTGGCCTCGTACATGCGCTACGCGACCGACCGCACGGTGCCGCGCCGCCTGCTGGGCTCGGCGGCCGTGTTCCTGCTGCTGCTGGTGTCGCAGGC
GGCCATCAAGTCGCCGGAGGAGTCGCAGATGATCATCGGTGTGCCTGCCAACGTGCTCTCGCTCCTCACGGCGTCCTCGCCGCTGCTGCAGCTCCCCACC
ATTCTGCGCCTCAAGGACGCGTCCGGCCTGCCGTCGGGCATGTCGACCATGAACATCGTGGCCGGCAGCGTGTGGACCACGTACGGCATCATGCTCGGCG
ACCCGCTGGTGATCTTGCCGAACGGGTTCGCGCTCACGATGGGGATCATCCAGGTCTCGCTCATCCTGCTCTACCCCGGTGGCAAGGTGGCGAACGCGGC
CGTACCGGCGACCAAATCGTCGGAGATCAAGAAGAGTGTCGACAGCAAGAAGAAGAAGGACAAGAACAGCGAGGAGATCCGCGTGGACAGTCCGGCGGGA
AGCGGCAGCGAGAAGGGACCGCAGTCGCGCCGTAAGAACGGACATGACGAGTGATCGAGCAAGCAAGCGAGTGAGATCCAAGGCGCAAGGGACTTGAGAG
TCTACGGACGTTGCATATGATGCATATGATGTGGTAGATATGTGAGCTGCTATGAGAAGGAGGCTGTATGTTGAACGACTTGAAGACGCCAGTTGGCATT
CTTCGCTTGAGCAGTTGGTGAGCTTTCGTCATTGATATATTTAGTGTTGCTGACGATCAAAGGGCACTGAACAAAGCAAACTGGGACTCGATGGAGGCGA
AGGACTTCATCATCTCGAATGTGGTAGGCGCACTGCATCCTCCGTGATGAGTGACAGTCGAGAGGCATGCATAATGAATGGTCAACTGGATCTGCCTGTT
TGCTTGCTGTGGTAGCGGGCGGGGGAGATCCAGGTCGAAGTGTTTGTCGCGGGGGACGGCATCAACTACCCCAAGAAGGGTCAGACCGTTGTGATCCACT
ACACCGGCTACGTGCGTTGTCGTTCGCTGTTGCCCACTGCATTACGTTCACCTACAAACCCTCATGTTCATGCTGTGGCCTGCTCCAGCTCCAGGACGGG
AAGAAGTTCGACTCATCACGCGACCGCGACAAGCCCTTCAAGTTCAAACTGGGGGCCGAACAGGTCATCCCGGGACTCGACGAGGGTGTCGAGCGACTGT
GCATGAAGGAGCGAGCCAAAGTGTTCATCCCCGCAGACAAGGCGTACGGCCGCAAGGGGTTCCCAGGACTCGTGCCGCCCAACACAAACCTCATTTTCGA
CATCGAGCTGCTCACGTTCCGCTAATGAATGGTACCATTTAATTCGGCGAATAGCTGCCGCTGTCACCTCCGGCTGCAGACCCGAACAGCTCCTTCTTCT
TGCGCTCAAACTCGCGCTTGCGCGTCCACTCGTCCTCGCGCGCGTCCAGCTTGGCCTGGATCGTCTTGAGCTGCGTCATGTGGCGCTTGCTCGCCGCACG
CGCCTTGGCGTCGTCTGCCACCTGCTGTTGAGCGATCTGCTGGTACAGGTGCTCCGTCACGGGCAACGGCTTGTGCAACTCCTGGGTGATCACGCCGTAC
ATCCACTCGCGCTGCACGCGGCCGTCGTTCTTGGCGGCGCGGATGAACTCGTCGCGCTCCTGCAGTTGCTTGCTCTGCCGGATCGTCTCCTGGATCTGCC
GCTCGTTGCACACCTTGCGCCAGTTGAGGTGCGCCACTCGCTCTTCGAGCGACGCGAACGATCCCGCCGACACCGAAGCGTTCATCGCGTCGCCCGCCTT
GGTTGCTGGACAAACAATGATGGCGATTCAAGACTGCTCTCCAGATGTGACTGAGGCGATCTCGAGTATTTTTGGCCGACCGTCTTCATACCTTGGACGA
CAGCTTTGGTGTCCTGAACCTGATGACTCGTCATTTGAGAGCCTCATAGAACACCGACGACACCTGGGACTGGCCGCTCCGAAATGTACCAGATCATCGA
CATAGTGTCATCGCCCTGCGCGAGTCGAGTCGGAGGCAGCTCATCGTCGACTGCAGCAGGTGGATTCGCTGGCACATGCGGACAGACCGAGTTCTGGTCC
TGAACACTGTCAGGAGTGATTTGTTGGTCCGATTGAGCACGATAACTGGTTGATATCTCGATGTAGTGCGTTCGCTCGCCGTTGCGCTTGGGCTTGGGCA
GCCGCAGACGGAAGTTCTGTCTCGGCAGGAACCCTGGGATCCTCGAGTCTCGACGCTTCTCCGCAAGCACGGCAACGTGAAGTTGGGTGGCCGCCAGCTC
GCTACAACACAATACAGCACCATTAGTCAACCTGCAAACAACGCTAGATATATGATGCAAGCGCAAACTACCTAGTGTGTGGAAACGTACCCAGTGGACA
GGAATGCGCCGTTGGATAGCAGCGTCCGCAGCAGTTTCTGAGCACACAGGCGCTCCAGCTTCTCCCTCGAGAATCCAGATGCTGCACTCGGATCAGCATC
GACTCGTTCCTTGTCACCATTTGCATCGCCTTCGCCTGCAGCGCTGAAGTCCACGACGAGCACCTCTCGAGGACTTAGCAGCGACGGCCCAAGCAGCAGC
GCAACTGCAACACACACACACACACACACACACGTATAACCAACAGCTCGTCAGCTCGGCAAAGTATACGCACAAGAGAGTTGGCGTAGTGAAGCAGACC
AGTCTGGACACGAGTGGAAAACAAACTGGGGAACCCATCGCGGAACAGAAGCGTCGCGGCGTCCACGCACTTCCTCGCCTTGCTCAGTGGACCAGCTGCC
AAGCGCCTGTCGACCCAATCTCAACCAGTTTAGCGCCGCGCTCGCCATACCGACCATATCAATACTGTCCATACCTTTGTGGTTGATGCAGCCGCACCAC
GTCAGTCTCGGATTGAATGGTTTGCTGTTGCTTGGCATCGATTACGATTGTCTCAAGCTGGTCATACGCACTGCAACACTCAGTCAGACCAACACGCAGC
AAAGTGACTGCACTGAATCGCGAGCAGCGCACCACGGAAGCTGGTTGCGCATGTACAGCCAGTACTTGGCGAGGCTCTCGACCAGCGACGCGCGCAACGC
GCCGTCCAGCGGCACCTTGAACTGCACTCCCGTCGTTCCCGCCATGCAGAAAGCGATCGTCCAAAAAATGCGTCCAACTGCGAACTTAGCATTCTAACGT
TGCGCGTGGGTGACATTAATCAATCAAAGTTCGCATTCGAAAGCGCACTTTACTCTCAGCTTTTTGACCAAAGCAACGACAAAAAGCAGTCGACCGAGGC
GACCAAGACGATGGAGGTGGCCGCGCACGTGGACGACTACAACGCGTCCTTCCGGGACACGGTGTGGCTGCAGTCGTTCCCGCTGACGGCCCAGACGGTG
CTGCACTACTTCGCGCTCTCGCCCTTCTACGACCGCTCGTGCAACAACGAGCGGCTCAAGATGCAGCGGCTCGGGCTCGAGCAGCTCAAGAACATGCGCG
GCGTCGAGTACGAGCTGCTGCCCAACCTGGCGCAGCAGCTGCCGCAGCAGCTCTTCCTCATCCGCAAGCAGCGTCGCAGCAGCCGCAACCAGGTTGAGCC
GCTCGCCGTCTACTACGTGCTGGACGGCACTGTCTACCAGGCTCCCAACATCCACGCCATGCTCACGTCGCGACTGGTACGTTAAGCCGTTTGTGTCGTC
TTGGTTTGACTATGGGAGGGACTGACCCTTTCGAGCTGCGTGTGTCTGCAGAAGAAGTGCAGCTACCGCGTGAACAAGGCGTTCCACGGACTCGCGGCCG
GCGTGCGCTTCAGTCCGACCGAGGGGTACGCGTGGGACTTCAGCTCGGGCGACAAGAAGGAGCCCGTCATCCCCTCCGAGCGTACGAACGACCGCTTTAA
AACGTTGGAGACGGTGTGAGACATTCACATTGTGTGTTTGATGGGTTGTAGAGCTGCAGCTCAAGCTGAAGCAAAAGTTCGAAAAGATGGAGAAGCAGCG
CGAGAACTCGGCCCGCGTGGACGCCATCCTGATCCAGCTCATGAAGAAGCACGCGCCGGAGATCGTCGAGAAGCTCGAGGCCAAGGACAAGGAGGATGCG
CGGACAGCAGGCGCGAGCAGCACGGGCGGACCCGCAGGCGAGGCACCAGGTCCGGCCGCCGAGGGCGAGGCCAACAAGCGCCAGAAGGTGGCATGAACCA
ACACCATCGTCCTCGATACAGCAAATTCAAATTGGCCGGGACGAACGCGTCCGGCGTCATCAACATGCAAAGAGATCCCAACACTGCGGTTGGCTGGCTG
TGCGGAGCGCCAGCGGACGAGCGCCGACACCTACTTGTCCTTCTTCTTCTCCATGTGCTTGCGCTCGTCGCTGAGAGTGTCGAGCGCCTGGTCCTTCGCG
CTCTTCATCTTGCCGCCGAGCGCGTCGCGGTGGCGGTTCAGCGACTTCATGTTGGCGTTCCACTTGTCCGGGTTGCGGCGGCGCAAGTACCAGAGCGTGA
ACAGCAGCAGCAGCGGCACCGCGAACCAGGTGACGTGGCGTGCACAGATGCGCCGGTTCGACAACGGCAGGCAGTACTCGCGGCCCGCGAGGTGCTTGGT
CACGTCCGCGTTCTGGTGCCACGTGTCTTGCGCGCGGCCGCGTGCAGCGTCCATCGACTGGCCCACCTGCCGCTTGACGTCGTCGGCGCGGTCG