Description :
From Genome Similarity Track
Location :
Scaffold_24:185722- 187911
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06258homeodomain transcription factor, putative

Sequence
2189 bases(100 bases per row)
AACGCTTGTCGATGAAGAGGTGCGCTAGCCTGCTGGAAGCTCCTGCTGGACGGATTTGCTATGTCGTCGTCCCGCTGGCTCGTGCACATGGTGGGTGAAG
TAATGCAAATTCGCACAGATGAGTTGTATTGTCTGATCCGAGTCATGGCCAGCTTACGTTTGATTGGACAAGATGTGATGTGGCGCGAATTCGATGACGG
GCGACTTGAGTTTGCTATGAAAAGATACGGCAATGTGGCCGTGGTCGTGGGCTGGTCGTTGGGACCGGGCGCACTAACGGGGAAGCAGGTGGAAGTTCCC
TCCGTAGCCGCTGGCGACTGCGTTTCTCTTGTCCACGGCTCATGCCAAAAATGCGTTGCACTTGGTCGCGGGAGGTCCTTGCCTGGATGCAGCGATGCAC
CCAGCACACAGTTTGCACTCCAAGCATTTGCACCTAGCTGCACGCGCTGGCACTCCTAAAAATATGCGACGAACGCCATCTCGCCCGCTTCGACTTGGCC
AAAGCCCTCGAAAGAAAGAACAAAAGCGATGGCGTTCATCGTCAAACGCACTCCCATGCGAGCACAAGCTGATTCACCGAGCTTACATTGTGTAAAGTTT
CGATCGTGGCACCAAGAGCCAGCATGCCGTTGGCGTCTCTGCAGTCCAATTGTACCCAGCCCTCTCCTCGCTTCGATGCTGGAACGGAAAGGAACGCGCG
ATGGATCCTGGATCAAAAGACACAGCTGCGCTTTCTTTTTATCTGGACTTGGTCAATGGATTCGAACGTGTCGTCGGCACGAAGTCGCGTCTGCACGAAA
GTCCAAAGATGCGCAGAATCATATCTTGGGTGCGGGATTAAACTTTCATCTTCCAGAGCTTCAACTTGAAGCCAAACATCTCCGAGAGCGCCGACGAGAA
CGCCGAGAGCACAACGACGCGCGTGATGTTGTACAAGAGCGGGTTCATCGTCAGCCCCGAGATCTTATTGGGCGAGTTGAGCTCCTACATGCACAATGTC
AACAACCAGTCCATGGGGCATCGATCGACCTTGAGGAGCTTGGAGGCGAGCTTGAGCACGTTGTTGGAGATGAGGAGCTTCTCCTTCTTGTGCGGTGTCA
TGAGCAGCTTCAGGTACACGTTCATTTGCTCGGTCAAGAGCAACGACGTGTTTTGGTACTTGCGGTTGATGTTGGAGCCGAGCATCATGAACCGCAAGAG
GAAAAAACTATGCGAGCGTTCGCCTCTCATCCTGTCGGTATTTCGTGCACTAGTACCTCGAGAGGAGACACCACAGCGTCACTTCCGTGTGCACGAGCGT
CGAGAAGAGCGACGCCGAGCTCGGAAGCGTCTCGGACACGGCTTGGACGCCCATGACGGCGAGGAAAAGCAGCACAATCAGAAACGACGTCGACACGATC
TCGTCGGCCGCTCGCTGCCGACCCTGGCGCTTGAGCCACGACCGACCACCGCGGAGACTCAGCCACGCCTTGATGTTGACAACGTTCTTGAGCCGAAAGT
GCGGCAAATGCGACGCCCGCGACCGCCGCGCCGACGTGAGCGCCGTAAAGCACTTGGCGTATCTAGCACGGTGCCGCCATGAGTCTCCTGCAACGAGACG
TCTGGGTACAGGAAGCGGCGGTGGTACGTAACTTCGGCGTCCGCGAGTGCGGAAAAGATGAGCGATGCCAAGATAAAGGTCGCAACCGTGCACGAAAGCG
CCGCGACAGCATAGAGACCCATGTGTAGCCATAGCTTCCGCTCCAGCGTCGCCAGCGGCATCGTCATGAGTGCCATCACAACCGAGCGCACATGCTACGC
GCATTCGTTGTCAGTGACTTGAACAAAGCAACGCACCTCAAAGATCATCTTGGGGTCGTACACGTCAATGTTGTGCTCGGTCGAGTAGCTCAGTGCCCGG
TGCGTCCACGGGACGAGTGCGATGATCGTCGCGCTCATGCGCGCCGCGATGCGGTACAGAGACCGCGGCGGCGTTGCTTTGACCTACTTCTGTATGGATC
CGGAACGCCACCATGAAATGTTCTACCTTGAGCAAGATGTTGGACCGCAGCTCCGCAATCGTCATCGACTCCTTGATCGGAATCCCGCCTTTCCAGACAA
CGACTTTGACACGTCGGTGCGTAAACGTGTCGCCAAACGACGGTTCGCTAAAGCTTCGCGTGGTGCGGCGCTATGCAGGCGACAACGAT