Description :
From Genome Similarity Track
Location :
Scaffold_138:185708- 187315
Transcript NameFunction/comments
Aphin_H310_12803Hypothetical protein
Aphin_H310_12804syntaxin putative
Aphin_H310_12805ras-like GTP-binding protein

Sequence
1607 bases(100 bases per row)
TCGTCGTGAGAACGATCTTTGGGCGGTTTCAGATATATGCCAGTGAATACATGCATTCTTGACTGGCAGTTTCATGGCTAAAGATAGCGGGAAGATGGAG
GACGCGATGGATTCTCGGCACTACTCAACGAAGCGCTCAACGCTAGTCGAGTCCACCAGGCTTAGTCTACTGCCAGCTCTCTCGAGCAGGCCACGTTTCA
CATCCTTGCACCATGCACGACCGCCTCGCAGAGCTTACAGGTACGCCGTGGCATTTGGCCATGGGTACACCCCACATCGATGCTGATCGCTACATTTTGC
ATGGGCTCTGCAGGAAAAGCGCCCGGAGAAGTTGCAATTGACGTAGCGGCAGAGGTAATGCGTTCACCCCGCTCAATATCCTATGGAAATTGTTGCGCTC
ATCGTGTGCACGGCCATGTAGAATCCAAAGTACGCTTCGCGGCGATTGTCTAGCCGTCCGAATCGGTGGGCGGGCGCTGATTGCCATGTAGTGTCGCACG
GCCCAAGTTTATGGAGAAGTTCTTCTTGGATGTGGAAGATATGCAAGCGGATTTGGGCAAAATCACGTACGGACGGGGCCATTCGAGTCGAGAGGATGGT
CATTCTGCGGACGTAGGGTCGCCACGGATCGCATTGGCGAGCTCAACCACCAAGCCCTCTTGGCGACGGCCACGGGCGAAGAACAGAGTAGGCCTCGATT
CCATCCCTCGATTGAACTGAGCGCGGGGTATAGTCATCAGCCAAGAGCTGTGTTTGGTCATCGACAGCACAAACAAGGTCGCGGCGCGGGCGAAGGCGCT
GCTGGAACTCATCAAAAAGGAGACGGCGGAGAAGAAGAAGGATAAGGTCGTCCCAGCGTCCGAGATGCGGTGCGTGCGCCATCGATGGCCACCATTTGAC
ACGTCATGTGTAGAATTCGAGACAACATGTCGACGACTCTCACACGGAAGTTTATGGACACCATGAAAGAGTACCAAAAGGCCCAACAGCGCTTCAAGTC
GGACATGAAGAACAAAGTGAAGCGCCAAGTTCAAATCGTCAAGCCGGACGCATCCGAGCAAGAAATCGACATGGTCATGCGGTCTGCTGACCCAGGTACG
TGCCACACTCGTCCGACGACACCACACAGGGTGGCCGCCGCTGACCAGACTCATGTCATCAGGCGCGATCTACCGCAGTGCCATCCTCCAGGGCAGCAAC
GACTCGATAAAGGAAGTGTACATGACGTGTCACGACAAATACCAAGACGTGCTCAAGCTAGAGCAGAGCGTCGCGGAGCTGCATCAAATGTTTCTCGACT
TGGCACTGCTGGTCGAGCAGCAGGGCGAAATGCTTGACCAGATTGAGTTTCAAGTACGTGTGCTTGGACGACCGGTAGTGCCAGACATGGTCCTCTAGGT
CAAAACGGCATCCAACTACATCGACGCCGGCAACAAAGAAGTCACGAAAGCACTCAAGTCCCAGAAGAGCATGCGAAAGAAGATGTGCTGCCTGCTTTTC
TTTGGGCTCGTCGTGGTCCTGATCGCGGTCCTCGCGTCCGGCGCGTTCAAGAGCAGCTGAGCGTGTCGTCGATTTAATGTCCACAAGACAACATCCATGT
CGAAAGC