Description :
From Genome Similarity Track
Location :
Scaffold_1156:1857- 6226
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1156-snap-gene-0.4Peptidyl-prolyl cis-trans isomerase FKBP5
Pytul_var.sporangiiferummaker-pug3_contig_1156-snap-gene-0.2P-type ATPase (P-ATPase) Superfamily
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1156-abinit-gene-0.8P-type ATPase (P-ATPase) Superfamily

Sequence
4369 bases(100 bases per row)
ACGCCAACCTTGAGCGTAAAGTTCTTGGCTTTCACACCTTCGTACACAAGCGCTTCGTTCCAACACGCACGATCCGAGTCCGCAGCAAACGACACGGCAG
CTGTGCGCAAGTGCTTCTTCGTCGACTTCTCAAACGCAGACAGCGGGGACACCATCGTCGACACGTACACCAGTGGCTCTTGGGTCGCATTGCCGAGCAC
GGGGTTCTGCGCGAGCACCTCTTTGAGCCCTCGCGCAGCGACCACACGCACCACGACGCGTCCGTCAGCCTTGTTCGTCTTCTTGTTCACATCGATGCCA
TTTTTGTTCTGCTTTGGTCGAGCAAACGAGTCCTGCGCGTGCTGCAACTCGTGGTCCAGCTGGATCGAGAGCACCTCGAAAGGCGAGAGCGTGACATTTT
CCCACGTCAACGAGTTGCCGAGCGACGACGAGTGTGAGTGCGCCGACGACGGCGAGCTGCTCATGGATCGCACGTCACTCATCTTCTATTCACTGGATGA
TAGCACTGCGCAGTAGTGTCTATTGCGTCTACACCAACAATGCAATGCGCGAGCGATTGATGGTGATCACCAGTGCTGTCCGTGAGTCAAATGGGGATCG
CGCGCATCATCCATCATCCGCCATTTCTCTCTCACAAAACTCAAAAGGGCAAAGACCAGAAAAAACGGAACCGGTCCCAAACGCTGAACCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCCGGCTGTCCATTTTTACCTCTCTATTTGCATATTTCACACAAGGCATCATCATCGTTCAGATATATTATGTTT
GGAGAGGGTTTTGGTTATTTCTACTGTTCGGGTGTCCCATCAGAGTGCAGGATTCCATCTACGAGAGACGCGCAGCGATGATGAGCTCAACGGGCACGCG
TCCGCGCAATGCGCCTTCTCTCTATGCCGGCGGCGGCGCCTCTGCGGGCGCATCGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCG
AGACGACGCTGGGAGACCTGCAAGAGCGGTTCTTTGGGAAAAGCCACACAAGATGGCGCCCTAGTGCTGCGGGTGCAGGTGACGATTTGGGTGATGGCGA
TGGCGCTGCGTTTGCGAACAATGTGGTCGTGAGCGCCAAATACACGCTGTGGAACTTTATGCCGCGTGTGCTGTTGGCGCAAGTGAAGCGTCCGTCAAAT
ATTTATTTTCTGTTTATCGCGGTCCTGCAGACGATCAAAGAGGTGAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGGCATGCCGACGA
TCCTGTTGCCACTCGTGATTGTGTTTATTTGCAGCGCGATCAAAGAAGCGCTTGAGGACCGGGAACGCCATCGTGCCGATGCGATCATGAACAGTAAAGA
AGTGCTGTGCTTGAGTGCGATGGGCGAATGGGAGATGAAGCAGTGGGGCGATGTGCAAGTCGGCGATATCGTGAAAGTGCTGAATGACGAAACGGTTCCT
GCCGACTTGTTTATGCTGAGTACGGAAGAGCTGGAGGACCCCGATGCGGATGTTATCGAAAGCAGAGATGCTACGCAAGATGACAGCACAAGGAATGACC
AAGAAAAGTATCAGCAAATCGATATCTCTGGCACCAGTACAAGCGCTACACCAGCAGCATCACATAGCTCGGGAGGAGGACATTTAGCGTACATTGAGAC
CAAGTCTCTTGATGGAGAGACGAACTTAAAGATACGCACGGCGATTCCGCTTGTTGCGATGCTGTCGAAGACTATGTCCGACCTCCTTGCGCTGCGTGGC
ACAATCGAATGCGAAGCGCCGAATAATCGGATCGCAACGTTTGATGGAAGCTTTTCTGTAGAGTTGAGCAACGTCCAAGCCAGCGTATTGGGTCTAAACG
CAGGTGCTGAGGGCGAGATATCATCACTGCCGAGAATTGGGCAATCGAGCCGCCATCTACAGCGTCAAGTAATGACCAAGCCTGATGGATCGCGGAGTAT
CCGCGTTCCCATCACGGCCAAGCAAATGGTGCTTCGAAGCTGCGTGCTACGGAATACGAGATCTATTGTCGGGATCGCGATCTTTACGGGTCACGAGACG
AAAGTTTTTTGCAGCAACACGGATCCTGTCGTGAAGACGTCGTCAGTGGAACAGCGATTGAACACGCTGATCATCGGTGTTGTGTTCATCCAGCAACTCG
TGTGCTTGCTGGGTGCACTGCTGGGTGCGTACTGGATGATCACGCAAGGACGCTCATATTGGTATCTGCATGGCGAATCCGTGGACAGCACAAGCGCCGA
GTATTTTCGAGGTCGTCATGCACATGACGATGGTTCGTTCCCGTTCCAAGAGCTCATCAAGCTGCACTTACGGTACTTCATTATTATGCAAAATTTTGTG
CCGATCTCGCTGAACGTGTCACTGGAGTTTGTCAAGTACTGGCAAGCGTACTTCATTGAGCAGGATCTCGAAATGTACGATGATACGTCCGATACTCCTG
CGCTGGTGCGGTCTTCGGCGCTGAATGAGGACCTTGGACGCGTGCATCACATCTTCACCGACAAGACAGGCACGCTGACCATGAATTTGATGCTCTTTCG
GTTCTGTATGATCAATGGCAAGCACTATGGCGGAGAAGTTCAGGAGTCTGAAATTGGAGGGACGCCGTCTTCTGCTAGTGCACTCCAACTGACTAAAAAT
CAAGACAAGCGTGGAGGTTCCCCGTTTGTAAACTTTGATCCGACTGACCTGTTCACGGATCTCCGGGCAGGAGGGTCTCATGCCGACCAGATTCGACTGT
TTCTGCGTCACTTAGCGCTATGTCACACCCTCATCCCCACCAAACCGCTAAAAGACATGTGCGCGGGTCCATCTCCAGAGTATTCGGCGTCGTCTCCAGA
TGAGCAAGCGCTCGTTTCTGCTGCCGCGCACTGTAATGTGCGCTTTGTGCNNNNNNNNNNNNNNNNNNNNNNNCGAACGCCGACTGCGATGATGATCATG
GAGCCCGGGTTTGACGAGCCATCGACGTACAAGATACTGCACTTGCTCGAGTTCGATAGCGATCGAAAACGCATGTCGGTCATTTTGGAAACGCCCGAAG
GAGAGATCGAGTTGCTGTGCAAGGGAGCGGACAATGTCATACTGGAGCGATTAGCTTCCACGGACGATCCAGCGCACGTCGACAAAGTGTACGACCAGTT
GTCTCTATACGCGAAATGTGGCATGCGAACGCTCTGTTTGGCGTACAAGAAGCTGGATCGAGCAGAGTATGCCGCGTGGAACACCCATTACGTCTCTGCG
ACGTCGTCGATGGACGAACTCGTAAAGCGACGACAGGGGCTTCCAAATGCCATTGACCCACTCATGAATGAGATCGAGCAGAATTTAACTCTGCTGGGAG
TGACTGCCGTTCAAGACAAGCTACAGGATGGAGTTCCGAGCACGTTGCAGTTGCTGCGGCAGACGAACATGAAAGTCTGGACGCTCACAGGGGACAAAAT
GGAAACTGCTATTAACATTGGTTATGCGTGTTCGATGCTCACGAGCAGGATGGAGGTCTTGCAAGTTTCCTCGGAGGATTATGTTGCTGTTGCGAGGGGT
TTGCAAGACGTCGCGATGCGCCAAGAGAAGCTCTCAGCGAAGTCTAGAGCGTCGCGATTGCGTGAAGCGAAGCGACAGCGTCGCATGGGGCGTGCCACGA
ATGCAACGTGGTATGAGCAATGGAAAACATCATTATCAACCTTTCTGTTTGGCGTCAGCCTTAAGAAAAAACATTCACGTGGACGGCTCCCGATTCGACA
AGCAGGTTTACGTGGCAGTGGCACGTATTCTCCCGTGTCAACCCTTGAGTATGATGACCTTGAGGGCGATGATGCCGATGATTCTCTGCTTTGGGGAAGT
GGCCCTCTGGCCGGTTTTGACACTCCAAACGGTTCGTCGTCGTCTCTGCCTTCGCTCGCGCTCGTGATTGATGGTAAATCTCTTGAGCACGCGTTGCGAC
CGCGCCTTCGCCCGCTTTTCTACCAAGTCACGAAAATGTGCACGTCAGTGATCTGTTGCCGTGTGTCACCGAAGCAAAAAGCCGACATTGTCGAATTCGT
TCGCCATTACGAGCCCGAGAGTATCACGTTGGCGATTGGCGATGGTGCGAATGACGTAGGCATGATTCAAGCTGCCCATATCGGTGTGGGAATCTCGGGA
CAAGAGGGAATGCAAGCTGTGAACTCGTCAGATTATGCAATTGGTCAGTTTCGATTTCTTCAGCGGCTG