Description :
From Genome Similarity Track
Location :
contig_48:185650- 187179
Transcript NameFunction/comments
g9820.t1POM78269.1 Hypothetical protein PHPALM_4218 [Phytophthora palmivora var. palmivora

Sequence
1529 bases(100 bases per row)
TTTGTATCTGCTTGGCGTGGACTTTGTGGCTGATTGTACTGAACGTCGCCCCTAACGAGACCGTGAACCGCGTCATGAACACGGAGACCTTCGACTACGG
GTCGTTCTGGCTCATGATTAAACCATCCGCAGCTTTGTCGGGAGTTACCACGTTTGGCCTCTCAGTCGTCGCTCTGGGATACCTCGCGGTTCTGATCAAG
ATGCTCGTTTCTCGTCGACTCGACTCGAAACGAGCCTACGTCATCAACAATTCCGGAAAGAGAGTTCATTTCGCTGGCAAGGTCGAGACGGTGCTCAATG
GCGCGGATGAAAAGCACAAAGGCGGGAAAATGGTTTCCACGGCGGTGAATTTTGCGGCTTCTCTGGCTCAAGAAGATAGCACGGCGAGGAAATACGTTGT
AAGTTCAATGTGGGCAATATGTTCTGGTGGGTATACTAATAATGCGATCGTCTGCAGAAACTCGGCTTGAAATTTGGAGACTTGGCGCTGGAAACAGTTC
TCCTCTATCAAATGCTCGAAGCTGGGTCACCTGCGCCACTGATCGGCGTCTTTACGGCGATCGTCGCGTCGAACGCCTTATCTTGTGCGGCTCTGATGTT
CGTCCCGTACGAGACAGCACCACTTGCGGAGACCCTCATCGACATTATGTACGTCGCACTTTTTCACTAGTGTCTTTCGAGTCTCTAACCTGATTTTTCA
ACCAGGTTTGACTTTCTCATCGGTGTGGGTTGCCCCATGCTCGTCCTTTCGTACTGCCTCTCCACGTTCACGTTCGATCGTGCCAAATTTGCCATCAACT
TGGCCGTTTTCCCTGCCGGGTGGTTTGAGCAGGGAGCTAGCGTTATCGCAGACCCCGTGGAGACCGCTGTGATCTACAAGAATCTCAAGTCTCTCCGGAT
CATGTCCGCGCTGGACTTTTTCACGCGTATGGGCATCAATTTGACTTTGTGCTACCGACTCCGCAACGTCGTGGAACTCATCAAGGACCCGAAAAAGCAG
CAGAGCAGCGTCTACCCGAAGCGCCATCGTCTGTCAGTGTGCGCTTTTGTGGGGTTCGCAGTGTTTTTGGTGGTGTTTGTCGAGGAGAGCATGCGGACGT
CTGATGTGGCATGCCACCCGCACCCGGAGTGCGTCGTAAAAGCACGGAGATGGACTAGCCTGAAGACGGACTCCTTAACCCAGTGTCCATGCATCATAAT
GATTGACCGAGACATTGCGCCTAAAACCTACGAGGAGTGGGAGAACCCAACCAACGTGACCGACAAAGTGGCCCAACTTGCTGCGATGGGAGATCTTCAG
ACAATTCAGTTGACGAACCGCTACATTCCAGTTTTTCCGGACGAACTGCGTCGCTGCACGAACTTGAGGCATCTGTATGAGGCTATTTAGTTCCTGGCTT
CTGTTTGGTTTGACCGCTAAGCTGACATTTCTTTTGGCTGCACTCTTTACCCAGGTCACTGGAGTACACTCACACGCAAACATTTCCCGACTGGGTTAGC
GAGTTTAAGAAACTCGAGTTCTTGTACGT