Description :
From Genome Similarity Track
Location :
contig_48:185621- 187150
Transcript NameFunction/comments
g10281.t1hypothetical protein

Sequence
1529 bases(100 bases per row)
TTTGTATCTGCTTGGCGTGGACTTTGTGGCTGATTGTACTGAACGTCGCCCCTAACGAGACCGTGAACCGCGTCATGAACACGGAGACCTTCGACTACGG
GTCGTTCTGGCTCATGATTAAACCATCCGCAGCTTTGTCGGGAGTTACCACGTTTGGCCTCTCAGTCGTCGCTTTGGGATACCTCGCGGTTCTGATCAAG
ATGCTCGTTTCTCGTCGACTCGACTCGAAACGAGCCTACGTCGTCAACAATTCCGGAAAGAGAGTTCATTTCGCTGGCAAGGTCGAGACGGTGCTCAATG
GCGCGGATGAAAAGCACAAAGGCGGGAAAATGGTTTCCACGGCGGTGAATATTGCGGCTTCTCTGGCTCAAGAAGATAGCACGGCGAGGAAATACGTTGT
AAGTTCAATGTGGGCAATATGTGCTGGTGGGTACACTAATAATGCGATCGTCTGTAGAAACTCGGCTTGAAATTTGGAGACTTGGCGCTGGAAACAGTTC
TCCTCTATCAAATGCTCGAAGCTGGGTCACCTGCGCCACTGATCGGCGTCTTTACGGCGATCGTCGCGTCGAACGCCTTATCTTGTGCGGCTCTGATGTT
CGTCCCGTACGAGACAGCACCACTTGCGGAGACCCTCATCGACATTATGTACGTCGCACTTTTTCACTAGTGTCTTTCGAGTCTCTAACCTGATTTTTCA
ACCAGGTTTGACTTTCTCATCGGTGTGGGTTGCCCCATGCTCGTCCTTTCGTACTGCCTCTCCACGTTCACGTTCGATCGTGCCAAATTTGCCATCAACT
TGGCCGTTTTCCCTGCCGGGTGGTTTGAGCAGGGAGCTAGCGTTATCGCAGACCCCGTGGAGACCGCTGTGATCTACAAAAATCTCAAGTCTCTCCGGAT
CATGTCCGCGCTGGACTTTTTCACGCGTATGGGCATCAATTTGACTTTGTGCTACCGACTCCGCAACGTCGTGGAACTCATCAAGGACCCGAAAAAGCAG
CAGAGCAGCGTCTACCCGAAGCGCCATCGTCTGTCAGTGTGCGCTTTTGTGGGGTTCGCAGTGTTTTTGGTGGTGTTTGTCGAGGAGAGCATGCGGACGT
CTGATGTGGCATGCCACCCGCACCCGGAGTGCGTCGTAAAAGCACGGAGATGGACTAGCCTGAAGACGGACTCCTTAACCCAGTGTCCATGCATCATAAT
GATTGACCGAGACATTGCGCCTAAAACCTACGAGGAGTGGGAGAACCCAACCAACGTGACCGACAAAGTGGCCCAACTTGCTGCGATGGGAGATCTTCAG
ACAATTCAGTTGACGAACCGCTACATTCCAGTTTTTCCGGACGAACTGCGTCGCTGCACGAACTTGAGGCATCTGTATGAGGCTATTTAGTTCCTGGCTT
CTGTTTGGTTTGACCGCAAAGCTGACATTTCTATTGGCTGCACTCTTTACCCAGGTCACTGGAGTACACTCACACGCAAACATTTCCCGACTGGGTTAGC
GAGTTTAAGAAACTCGAGTTCTTGTACGT