Description :
From Genome Similarity Track
Location :
Scaffold_2301:1856- 4004
Transcript NameFunction/comments
Phypl_g14931hypothetical protein

Sequence
2148 bases(100 bases per row)
TGGAAATGTCCGCAAGCCGAACAATTTGGTACTGGACGAAGCGACCAGCGCTCTGGAcaacgagagcgagaagatCGTGCAGGCTGCGTTGAACGAAttg
atggccacgacgaACATGACGACGTTGGTCATTGCTCACCGTCTGAGCACCATTCGCCACGCCGACAAGATTGTGGTGTTGAACGAGGGGCACATTGTGG
AGAGCGGTACGCATCAAGAGCTTCTTCGAATCGAGCACGGTATCTACCAGAACATGTACCACATCCAGGagttgcgctcgctggaggAACAGGAGGAAAT
TGAGCGACACGGGGCAGAAAACGATCTTGGGAGCGCGAAGCTGTCTCGTACGTTGAGCGGTGTGTCGGTGAAAACGGACATTTCCGTGAGTGCTGTGGAG
AAGAACTTCTTGGACAAGAAGCCGTTCGGTTTCGCTGACCTGCTGAAGCTTAACCGACTGGAGCTCAAGTACTTTATTGTTGGTCTCGTTGGCTCTTGTG
GTGGAGGTATCGCACAGCCAGTCTCTGCGGTGCTGATCACGGGAATGGTCACTAATATGACGAAGCAGTACGGATTGTACCAGAGTACTGGTGACAGCTC
TTACCTAAGCGAACTGTACGGCAAAGTGGAGCTGTACGGGATTCTGTACCTCGTTGGCGCTGTGGTGGTCGCGATTTTCACGTATCTGCAAATGTACTGC
TTCAAATACATGGAAGAGAAGATCACGACGCGATTGCGGATCGATAACTTCCGAGGCTTGTGCCGTCAAAATGTCGGATTCTTCGAtgagaaggagaacg
caACGGGTGCATTGACCGCCGACCTCGCCACGAACGCTACCAAGGTTTCCTTGCTGTCTGGGGAATCACagtccgtcttcttcaatgCCGTTTTCACTTT
GCTTGCCGCCCTGGTGATTTCTTTTGGATTCGGCAGTTGGCTCTTGTCGCTTATCATGCTGGCGCTCATTCCGTTGATGCTATTCGGAGAAGTGGCGCGT
ATGAAGGAGATGGAAGGTGCTGGTTTGATTTCTGACGATCTTGCGATCCCAGGAGCCCACGCGTCCGAAGTTCTCAGTAATATTCGCACGGTCACCTCTC
TAGGTATTGAGAAGAGATCCGCTGACGTCTTTGACGACTTGCTGGAAGAGCCACTCCAGAAGGGCCGCAAGGAAGCGCAGTTGAATGGTCTGTCCCTCGG
TTTGAACTCCTTCATGATGATGGCGACATACGCGCTCATCTTCTGGTTCGGAGCCAAGAAGGTCGACGATGGGACTATTAACTTCGCGGAAATGATGCGA
ACGCTGATGGCTATCATGATGTCCGTTCAGACTGTCAGCATGGCGTCGAAATTCTTGAGCGACGCACCGAAGGCATTCAAGGCTAGATCGACCATCTTCG
CTATCCGCGATCGAATTGCCCCCATCGATTCGTTCAACGCCGATGGACTCCGTCTCACCAAGGTCGACGGTCGTCTCGAGTTCAGGGACATCTCGTTCCG
ATACCCGACCCGACCGGAGAtcaacgtgctcaagcacTACAACCTCACTATTGAAGCTGGTCAAACTGTGGCTTTCTGTGGACCAAGCGGGGGTGGCAAG
AGTACCATCATCTCGCTCATCGAGCGCTTCTACGATCCTGTTGTCGGTGACGTTCTGCTGGACGGCCACAACATCAAAGACCTGAACTTAGGCTGGCTGC
GCAATCAGATCGGCCTGGTCGGTCAGGAGCCCACACTGTTCATTGGCACTATCGCGGAGAACATTTCGTACGGTCTGGCAGAGCAACCGAGTCAGCAGGA
GATCGAAGACGCTGCCAAGATGGCCAACGCCCACGACTTCATCACGCAGTTCCCGGACGGCTACGACACGCAGGTGGGCATGAAGGGTGAACAGCTTTCG
GGTggccagaagcagcgcatTGCAATTGCTCGCGCCATCCTGAAGAATCCGAacctgctgttgctggacgaAGCTACGAGCGCATTGGACTCggagagcg
agaaggtggtgcaggaggctctggacaaggtggtggcgTTGAAGCGACGCACGACGATCATCATCGCTCACCGCTTGTCGACGATCCGCAAGGCGGACAA
GATCTGCGTGGTGAGTGGCGGCAAGATCGCGGAGCAGGGCACGCACCA