Description :
From Genome Similarity Track
Location :
Scaffold_19:185575- 190406
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007669Protein of unknown function

Sequence
4831 bases(100 bases per row)
CTGGAGTTGACATCGGAGGGTACAGTGATCCATACTGCACGCTCACGGTGACTGATCGTGAAACAGGGAAGCCTGTCGAAGTTGAGAAGAAGAAAACTGC
AATCATTTCAAGAACGTTGAATCCTGTGTGGACGAACGAAGTTTTCATATTCGGCAATGTAAGTGTTCTCTATCGTTCATGTGAACGCAGTTGCGAATGT
CATTAATCCTAACGTTGATTCTTTGTATGCGTTCTTTTATCAGAATCATCCAATATTGGAGTCGGGTATGCTTCTTATTCACGTGAAGGATCACAACAAC
ATTGGGCGAAGTACACCACTTGGTCGTATCCAAATTCCAATTCACGAGCTTTGTCACGCGTCAGCAAACTCCACGTCTATTGCGTCGACCTCCCAACAGA
AACGCTATCCATTAGCTCCAGAGCCATGGATGAAAAAGCATGCACAAGATCTTGGCGAGTTGTGCATCAAGACTGAAGTTGTGGGAGATGCGACCGTGCT
TGCTGAAATGCTTCAGCGCATGCCGAAGAAGTCGCCTGAAAAGCTGCTGAGCTTCCTGTCGTTCTCTTCTTTCACGACAGACCCGTACGTCCAAAGCCAA
AGTTCGCTGGATATGAATTCTTCGCTCAACATAGACTCATTACCGGAATTTGAAGATGAAGTCACGGAGGTATTGGATCGCAAAAATGAATTTCGGACGG
CTGCGGTTGTTGGAAGTGCTGCCAAGTGGAGGAAAGAGAAGTTCCAGCTATCTCTTTCCTACCCGGGAATGTTTAGCGACAAGAAAACAGAAAAGTTTGA
GCACTATGAGCTTCATTTGCGTGTGCATAGCGGCCGTCACCTGCTAGGATCCCAAGGCGTCGCTTCAAGTCATGGTGGAAATTCTCAAGACCAATCAGAC
GGCTATCAGCTTCACTATCATCGCGGCCATTCGTCGTCAACGAATGCATATTTCACGGCGATACCGGTATTGGCAACAGGTGAGCTGGAGCATTCCGAGA
AAAAGCAGGGGCTAACAGTTTATGGTACGCGCAATCCTTCTTGGCCGAATCAAGAGTTTGTATTTGGCAAAGTCAAAGATATAGCGGCTATTTCGTACCT
ATCTCTGCACGTCTACACTCGCAACTTAGCGGGAGAAACGAAGAAGCACCTATCGTTGCTGTTGAGTGAGCGAGAAAGACAGCAAGAGATCCATCTCAAG
CGACACCAACTGCACAAATTGGCACCGTCGGGTGAGATCTGTGATGATGGATGCGAAGTCTTGCAATATGACCAGCGTGTGTTGGCATATCGAGAATGTC
ACGGCAGTGGACGATTTTTTCCCGCTCGAGTTCAACGCTATTACCCGTTCCCTCAGGATGAGTACAAGGTTCTTTTTGAAGGCAGCATCGAGACAGTGGA
TGATGTTCGAAACATTTTTTCCATTGATGTGAAAGGAAAAATTAAAGCCCTTCGGAGTGATGGAAATGCAGATGTAGTGTTACTTGAGCAACAGGATCCA
AGCAATGCGTACGCCAAGAACGTCTCACCGGCATTGCTTACACCAGTCGGTTCGTTCTCATCATTGATCGAGAAGACGATGGCAAAGCGCGTGAACAAGA
AAAATGACACGTCTTCGCAATGGGAACGACTGAAGCATACTTTGACTGGCATGAAGGTCGAAGTTTTGTCTGTATCAAACTTGCCTACTGGTACGACTTG
CCCAGGATGCCTAATCACGATTGTTGGAAATCCAACCGCGGTACCAGGGGCAGAGAACAAATTTACGGTTCACTCAAACGGTAAAATGGTGGCTAAGAAA
ACGATACGTTCCATTGGCTGGAAAGTTGGAGAGTCATTCGAGTTCCCGGTGAGTAAGAGCGCTGTCAAAACAGACGTGGATCATCGGCATTTGTTTGAGA
TCAAACCCCTAAGGTTAGGCCAAGCCAAGGAAGAAGAAACAGTTGATGATGACCAAGATTCAGGCTCCAAAACACAGCAAGATTTGATTGAGGAAAGCAT
GGACATTCTTGCCGCTGTTTCAAGCATTTTGATTGAGATAGTTGATCAAGGCGCCGACAAGGAGCTTTCGCGAGCACATCAAACTATTGGAGTAGCAAAA
CTTGACCTTGCAAGTCTTCGTGATGGTGAGCAAGAACTGAATCTCAAGTTAATTCCGAGTGAGAACACACCGTATTACAGGTTTGTCGGATCGGTATGCG
TTCACATAACGTGCAAGCAGAATGAGGAGGCACATAGCGCTGTGTCTGACTTGCCTGGACACGGAAAACGCATCACGAAGTTGAGTGATCAGGTATTTGT
TTGTGGGATGGCTGACTGGTTCCGATCTCGTCAAGCAGCTCCAGCCTACTCGTCCTCTCTCACGTTGCCTACTCGTACCCCTAGTCGGATTGAGCGTCGT
GAAATGCTGCGTGCGTCACTGACGCCGACAGAAAATACGCAGATCGATGCCTTCCATGTTGTTCTTGTGATTGTTATGAAGCGAATTGTGAGTATACTGT
GTGAGATTCAACTCTTTGAGCAATTTGAAGTACTCGAGAAAGAAGAAATGCAGAAGTTCCGGCATGTGCATACAACGAGCGCGGATCCGAATAGCGAGTG
GATTGGCCGACTGATCAACGAAATCAAAGTGGAAACAAGAAAAGACATTGTACTTCATCTCGAGATGGAATTGTTGGAGTTAGGTGCCTCGAAGACCTCG
ATTGAAATCCCTGTGACGGATCTTGAGCGTGAGGAGTGGATCAAGCTTCGTGCGGTTCGACAAAAAGCCTTGCAAGACATTGGTGGATTCTTCATTCAAG
ACCGAACGAATGTTCTCTTTCTTTCATACCCAAACTCTTTCACTGGCGAAGGAATGATTTCTTGGATTTTGCGATCCCCGTCCATACTGTGGGAGGATGG
GTGGAAAAAGTATTGCCAAGATCCGAAAATCAAGTCATCGTGTCTTTTGCAGTGGAAAGATGGCAAGCTCGAGCAAGATCCAGACGCGATTCAGCCACCA
CGATCACGAGAATCAGCATTAATGTGGTTGTGTGGATTAAGTGACGCAGGATATATTGAAAATGTGACCTCCAGTGGAGCAGCAACCGACGCAAATATAA
ACTACTACCTGGTGGAAGATAAGACTGATCGCTTCTATCGTCTTCGTGAAGTGGATCTGTGGTTGAAGAAGCAAAGCCGCGAAAAAAGTCTATTTCCATT
AGATTTGGTGCAAGAAATTGATTGCTACCAGTCTCCATTGTCTGGACTGACGCCAGCAGATGTGAATCTTAACCCAGAAGCTGAGCACAAGAGTGTTTTT
TCAAAGAAGCTTACCGATCACGTGGAGGACTTTTTGGGAACCCATACCAAGATATCAACCCTCCTGTTTTCACCCGAGATTAAGGCGACTGACCTGCTGA
AACCTGTAGTCGAGAAAACGAAGCAACTACTTGACGAGGACATGCTGTGGGATTGGAAATACTGTTTGTTCATCCCAGACTACCGCTCGATTTACATGTA
CGAAGCTGAAACGTGTTCGTGTCCTTTTGCGATTATTGACATGAACAGTGGTTCGTGCCACGCCTCGTACAGCTCTATTCACGAGGACAAAGGAGGATGG
TTCGAAATTTCAAATGCAACGGTCTTTGTTCGTGATAGTGCGAGTGCAAAATATCTTCCAATCGATGACGAACGCAAGGCAAAGATGATGAAATTGAAGC
CTGATGGGAGCATGGTGCTGGAGTTTAAGAGTGCGGATGCCCAACGCTGGATCCAAGCGCTTCTTCGAGCTGGCGTTAAGATGAAATTACAAGTTGGGCA
ACTTGTGGTCATGAAGCAGCTCAATGCAATTGTTCTCCAGCAAAAATGCATCGAATACTCGACGGAATATCTCCCACATGATCTGGAAGGAAGTTTTCAA
CGGCTTCTCAACCGCTTTTTTGGGCATGATTTGGATTCGTCACACCACGAGTACGAGGAAAAGATGCGGGAGTTACGTGCACAATTTCGCTGCGAAATGA
AGAAGACGGGGCATCTTGGTGACACAGTGCTCGCGTACTATGGGAAGGGCAAAAAGCTGAATCCAAAGCCGACCGATTCGCGGAGTTTTACGCCTGGCGC
CTTGTACTCTGGTCGGATCGTTCGCATTCGAACTCCTTATATCGATTCAAAATATCATGTTGCTACTCTGTACGACCGAAACGACAAAAATGAAGTGCCG
CCAGAAGTCGAGCAGTTGCTACTCAAGTATAAAGTGAAGGACAAGGCCTCGTGGTTAAAATTGCCCACAACCTTACGTGATGTGTTTTTGTTGTATGACA
TCGAGTATCGCCATTCTCACGAGACTATTATCGAAGAAGGCATGCTGCGCGAGCATTTCAGAGCCGCAAACGGAGATCTGGATGCTGCGAAGGTCGAAGA
GCGCTGCATCGATTCGAATTTGCTGTTCAAGCCGAATGACCTGGAAGACTGTGTCACTCGAATGACAATCAACTGTAATGGAAGGAAACCTCTGGGATGC
TTGAAGATTCCAATCAAGATGGTTTCACCCCACCGCGTGTCTGATGTTTGGTATCCTCTAGCGCCCGAGAGCGAAATGGTCCAAAAGATGCATTTAGGCC
AATTGCGCGTTCAACTTCGCCTAACGCACGTGAACGAGTTAGTGCGAAGCGAGACAAGGCCAGCGCTTCTCGAAGAGCTAAAAGATGCAGTTGCGAAACA
TCAGCTTCTACAACCATATATACCAAGCTCGCTATCGTTTTTCACAAATAAGCGGAGTGCTCGACTACCAAGTGGAGGCAGCTCAGTAAACTCGCGTGAG
CAATCTTTCCTAAAGATTTCGATTCATGAGG