Description :
From Genome Similarity Track
Location :
Scaffold_77:185562- 190614
Transcript NameFunction/comments
Phyci_82888Hypothetical protein
Phyci_82889Hypothetical protein
Phyci_197735Hypothetical protein
Phyci_68374Hypothetical protein

Sequence
5052 bases(100 bases per row)
TGCAGCGGTAGCCGGAGACACGCTACttccagcagacacttcgcaaggtcgttacctacgacacgaaggagcatgagagTGGGGTGAACTCTCAGCATTT
GTATACTGCAACTAAGGAGGCCTGTAGCAAAGATAAACGAACAAAAACCACTGCGGTTTGCGCCGCAGTGGCTGCATAGAATACCGGGATCCATGTCACC
TCCAAGCACGGATTATCAAGTACGTTAGGGTCAAAATACACTACAAAGATAACTTTAGTTGTGACAACGATCCAACGCGGGCCATGAGCGGGCTCCAGCA
GAAGCGCAGTCGGGCGAACACCGCAGGAGATGACGGTGATACACCGCAGCCGACAACCAAACTATGGACAGTATTGGAGCCACCTCCGATTGTCTGTTTC
TCACACGAGGCTCTCGTCAAGTGGAGGAGCTATACGAGGCGGCCGTGGTTGCACGCTGCCAGGAGTCGGGTGAGTCACTGGCTACGGTCATGAGGCCAGT
GATCACCACTATTCACCGCCGCTTACTGGAGACATTTTGCGAACTGGAGCTGAAAACTGCAGTGAGTGAGATGGCGAACGACAAATTGATTACAGCGATC
AATCAGATCTTGGCTACCATGATGGGCGATCTGATCCCGGATATTCATGCGATCATGAGCCAGCACCTGGTGGTGGATCTACGCCAGAAGGACGTTAAGA
CCAGGGTTTTGAATTACTTTGACAAGTTTGACGAACTCATCGAAGCGTTGGTATAAGCGTGTAGATGGCAATGATAAGTTAAAATGCCGTGTGTTGACTG
AACTTTTTCACCTATCCGGACTGAAGGAGGAGGTTTTGTTGTATCAGAACCTCGATCCGATGGTGAAGATCAGTGTACCGCACTTGTTTGTTGTGATCAA
GGCGGAGGCACTCAAGAATCAACAATCCTTCGATCTCTTCCACTCGACCAGAAACAAAGATTCAACTAGAACTACAAAGAATCCTCCTCGCGACAATAAT
GGAGATCGCAGTAACTACAAATCGCAAAAATGAGATTGACTGTATCCACTGCGCGATGATAGGCGGGATGAGCGGACGGGTTTTAAGAAGCGCGATCATG
TTCCTGCTCAGCGCTGTTTGCATTGCAAGGGCACTCACTGGGTCGGTGACAGTCATTCAGCCACGGTTGATTAGGAGAAGGCAGCTCGACAAGCATTCAA
GGAGCGCATGAATCGACGCGAGGATGCTGAAGCGGCTAAAATGAAGCACGTGTTGGACGATGAAGAAGACCTCACCTCGATACATGATGCATTTAATGGG
GTTGTGACAATGCCCTACTTCCCAGACAATGGCACGAAATACAATGTGATTTATCGGCGAACTGTGAAGGAATTACTGCAAGCCTGCCCGGATGTGAATG
TGGCTCGCATACGAAAACCGATTGGTGGCAAAGCTGTTGGAGGCGCAATCATCAGTTGCGATGAGTCGATCCAACTGGACTTGGAGTTGATCTCGCCTGC
AGGAAAGGCTCGAATGCGCAAAGTGACCTGTATCATCCCGGAGACAGAAGGGGATGAGTTCCTGCTGGGCTGACTGACATTAAAGGCTCTAGGAATTGAT
GTCGAGGCAGCTGTCTGCACTTGCTAATAATGAAATGGTAGGTTTTGATCCGTTCGAGTCGGTGACTCCAGTCAGCTTCAATCTCCCGGGAAAGAAGAAG
ATTATTGTGCGGCTCTGCGAGTTGGTCAACGACGCTGTCGCAAATGGTTTCCCTGCAGAGCGTAAAAGAGAATTGTTTGAAGTTGCCATGCGGTACAATA
TCTGGCGCATCGCCATTGAAAATGACCCACCATCGGAGATTGAACCGTTGGTCATTCGGTTCAAGGATGGAACTCTGTCAATACGGTGGAGACCTCGCAC
CTACGCACCTGCGGAGCGCGAGTGGATGAAGACATTTAACGCATCACTGGTTGCCATTGGTTGGGTGTATCGAAATGAGGCTAGTCGATGGGCTAGTCCT
ACGCGCCCTGTGAAAAAAGCCAGGAAAGAAGGGAGGACTCCGTCAGGCAGTCGATTTTCGTCGATCTAATGCACACGTGATACCTGTTGCTGGATCCATG
CCCAATCTCAGTATTCGGCTTCATCAAACGAAGAACATGAACACAAGCAAACGGTGgattttctgaagagctcttggcaaatggcgctcgctgagataag
tcaagaatcgcagtcctacatgacggaagatggcgtcttcgcatcaacgcggctacagcaaggatctgtcgattcttcaattcactttcagcaagcgatc
gaaaagataatgcgacatgcaaacattttgtacgagaatgtactggcgtgtgtcgatgaccttctTATCTACGTAGACACGATCGATGATTTTTGTCGGT
TCTCGACAGCGTCTACGGCACTTTGGCGGAGAACGGCCTATTTCTCGGGCTGGATAAAATCTGTGTGTACACTACAGAGGCAAAAAACTGTACGGCCGGG
TAATCAAGGAGGACGGGGTCGGTTACGACCGCAAAAAGATACAGATGCTGATCGACCTTCCTTAGCCTCGAACCGCTGCTGAATTACAACAATTGTTGTG
TGCAGCAGGCATAGGATGCGCAGTTCGCGGATTGATTTTGCTCGTGTAGCTGCTCCATTACAAACGCGTCTGCTTACCGCTTTGAAAGGGACTCAGCGGA
CAAAGAATGTTACAGCACGGCGTGCGATTAATTTCATTGAGGAGGATTTGAACAAGTCAAGCACCTACTCGCTAGCTCAGCCACCTTGGTGACGCTGGAT
GACGCCGACGAACTCATATTGATGACAGCAGCTAGTGATGCAGGATGGAGAATCATAGTGACGGTGGTCACGGACTGGGATCCTTACTGAGTAGCAGCAG
CAGCTAGTGCAGTGCATGAGCAGCACGTTCATGGGAGCCGCTCAGCAATGGAGCGCCTCGGAAAATAGGCATTTCCTATCATTAAAGCAACGACTGACCT
GGAATATTCGCTGATCCGTCCAGAAGGTTTCCGCTTATATTCAGACCACTGTAACTTGATCTTCATCTTCGCACCAAGAGATGAGGTGTGCGGGGAATTG
CAGCGATGGCGTTTGAAACGGAATGAACTccggtacaccattgaacatatcagtggacaagcaaatgtgtgggctgatatgacatcccgttgggcCTTCA
GCGAATTACTTTGGGAGACTACGACGATTAATCGCTGGCAGACACAGGATGAACACGTGCCAGTGGAGCTTTGGACTCTACGTCACGACTCGGACTGGAC
AACTAAGGAAGATATCAAGATCGCTCAATTAGCGACGACGTGCACTCACCCACCACATCTCGAGGAACTGAGTGATGGGTTGTGGAGAGATAAGCAGAAT
CGCTTGGGATTCCGGCAGACGCAGAAGTGATCTTCGTGAGGCTGTTGGTGATTGCCCATTGTGACACAATGGGACATCGAGGGGTGAAGGTGATGATCAA
CTACCTCCAAGAGCACTTCCTAATGGAAAATTTGGAACAAGAACACGGGAACTCTGTAGTCTCTGTCATTTGTGCTGCCATGTCAAGGGTGGGAAAATAA
TACCACGACCTTGGGGCGAGACGTATCGCTCCGTAGAGCGCTACGAAGCACTTCACATGGACTACTTATTCATTAGTGATTACAATGCCAAGAGCAACCA
TGTGTTGGTCATGAAATATGACTTTTcgcatttctgtgaattgattgagtgtacgagtgcgaatgttgacacagcagctagggcgattcttgactgaaac
agtcgctacggtatcccttggttgctgatcagcaataccgcaacacacattaagaactagctactagagaaagtgcgccacaaaacccagatgactcaaa
gcttcacccttgcctactgcccgtggatcaatgacaatgtagagcgactgaatcgagatatactgcaggttctgcgagtcatgctattggaatacaaCGT
CGAGCAAGATAATTTGGCCGCGCTACTGCCACTCATTCAAGCAAATATGAATCATAGCCCAGTAGCGCCGTTGGCTAACCACGCTTCGGCAGAGGTCTTT
CTTGGAGTAAATGCAACGACTCCATTGCATAAAAGTCCTGGTCGGCAGTGATGCGATTGCGGCAAATGTGGTGAAAACGGGCGAATTCTCGCCAGATATC
CGTGAGGCCGTAGCCAACTTGCGAGCATCGCTCGATGGCATGCACCGAGAAGTAACTGGCGCGAACGCCAACCCGTTTCAAATTGCGCATTTGATCACTG
CAGCGACAAATTTACCCATGCTTCGCGCCTGAAAATGTATGCAGACCAAAGACTTGATATAAACGAGGAAATGTTGGCACATGTTACAAGCCAAGATATC
TATCATACGGTGGAGGCTTTCATGCAACAACTTGAGCATGCAACAAACAAGTATGAAATATTGGTGCGTTGGGAAAGCCTCGAAGCCCTCGAAGACTCTT
GGGAGTCTGTGGTGACCATGTTTGAGGATGTACCGATCAAGTTGCAGGACTACGTGGACGGTGGTAACGACGACGGATTGCGTCAGTTCGTGCTCAAATT
GAAGTCTCGTCAGCAAGGAGGTAAGCGTGATGCAACACATGCACCACAACCTCCGCCTCGCGGCTAGCATGCTAAACTGCAAGCTGCTAAACCGAAGCCA
ACAACTACTAATCGCCGCCGTCGCCGCACCACGAACACGCTCAGTATGTAACGGGCTACAAGCTGTGATTGTGAGGCTGAAATACAAAGGTCCGCTTGGA
GGGCGGTGTTGGGACAGCCTGTAACAGGCTACttccagcagacacttcgcaaggtcgttacctacgacacgaaggagcatgagagCGGGGTGAACTCTCA
GCATTTGTATACTGCATACTAAGGAGGCATATTGCAAAGAATAACTAACAGAAACCACTGCGGTATGCGCCGCAGAGGCTGCATAAAATACCGGAATTCA
TTTCACCACCAAACACGGATTATCAAGCACGTTAGGATCGAAAGACATTACA