Description :
From Genome Similarity Track
Location :
Scaffold_137:18551- 19587
Transcript NameFunction/comments
Albla_Nc14080310HECT E3 ubiquitin ligase putative

Sequence
1036 bases(100 bases per row)
TTAGCTCTTCTTGTGTCTGATATAATGGAATATCAATCCGATTGAAACAAGTATGTCCTTTGGGCATCAAGCCCGCAGGTGGTGGTCCTCTCTGCACGAA
TTGAATGGTAAAGCGTCGTACACGACCATCGCTACTTGTCAATGCTTTAAAGCCTTGCACTGGCACACGACTTGTCCCGGTGGAAAATTGCAATAATCGA
GCTCGATCTTCCGCACTGAAATGCTCTCTCAAAACGGTCCAAAACCAATGCAATACTTTTCGTTCCGTATGTGTTGGTTTCTCAAGCTTCACCCATCGAA
CTTCTGTGTGGGATACCCAGTCATCGACATCAATTTCGGGAATCCCTGAGAGTAAAAGGTCAAATTCCTGGTAGTCAAAGACGGTCAACAGGTACGCCGG
GACAATATCATACAATCCTTTCAGCATAGCAGTTAATTGTTCGGAAATACTGGAGAACATGTGGTACTTTAACAGTAAATCCATGTACTCCTTCTTATTG
TCGTCATTGACCTCGATATTTCGACCATTTGGCTTGAGCTCCATGGTAGCTCGTGACCCATCTCGCTGATATTGCTGGACTGTGAAATCGATACCGACGA
CTTCAGCGTGGTCATTGTTCTTGATCCAGCAGACATTTTTGTGCAGATTTTCATCGAGATACTCCAAATCGGAGAAGGAAATTGGGACACCCAAAAGGTG
TTTGATCAATGGGAGTGCCAATGAGACTTTCATGTTGTATCCTTCGATGAGAGCTTTGCCAATGAGTCGACCGACGAATTCATAGTAGAGCAGGTGATCC
GGGACATTGACCGAGCTTGCATTGATCCAGTAACCGAACCGTTCACCTTTGGTGGCTTGGAAGAGACCAAACTCATCGCTGAAAAGCAGGTCGCTTAACA
GTTCATACCATTCGCGTATAAGCCCACCCGCATCCAAACCCGGTTCATTTTCAAAGTAAATTCGTAACCGTTCCCAGAACCGGCTCGCGGGACATTTTAA
CATTTGTTCCATGGAGTCACTTAACAGATGTGTGCG