Description :
From Genome Similarity Track
Location :
Scaffold_115:18541- 22226
Transcript NameFunction/comments
Phypl_g3459hypothetical protein

Sequence
3685 bases(100 bases per row)
CGTTGCcagcgacttcaacttgggctggtgctgatggacCCCTTTCTTGATGGCCTCCTTCCTGGCCTTCCACGTGCTCTCCCGGCCCGCGTGACGCAtg
gcgagctccagctcttgcTCCAGATCGCTGCTGCGGGCGTCGAACCGCTCCAGTTCCGCCAGTGCGATCCACTCGAACAGCGGCACAATGCTCAGCGCGG
TCGGAGCCAAAAGCGttgcagccacttgacgggCGAACCTCACGGCGCTCTGCGGAGTGGGGAAGCACTGATACACGTGCACGACAATGGCCTCGATGCA
CGCAGGGTCGGGTGACTGGAGTGACACGCTCACGCACGCAAAGCGCTGGCCCGTGGCCTGGGGCAGGTCTGCAGCGCTGAACTGGGCGGTGCTGGGCCCA
gcgtcgccggcgtcgccaCTAGAGAAGTTCTCCAGCCCCATCGTcatctcgtcctccttgtaGACAGCGAAGCGGCTGCAGTCGTGTCCTTCCGCCCGCC
CCACAGCTTTCTCCACGGCGCAGATTTGCCGGAACACGTCGAGTGCGTCTTCAATATCTCGGAACTTGCCAAACACGCGGAAGCGAGTGAACTCCATGTG
GCCTGCTGCGCTTAcagctgccgtcgccgcttTGCGGAGCTGATCTGCAGCAGACTTTGCGGACCTGGCCAATTTACcggacgacaaggacaaggacaag
gacatCCCTCTGGACGCGGGTCGAGCCGTCTGCTCCTTCATGAACCCCAGCACAGCGAACGGCTGGCACACACCGTGCACAGGGTCCCATattgtggcag
cagcactgaTGGACGATCCTGCTGGACCATTCTTGGCTCCGTTGAGCGCGttgtccaccttctcgacaCGAACGCGGCCGCAATGACGCAAATCGGAACA
ATATTCCTTTCTGCCCGCCGATTCCTCTTTGATCGGAGACACCGCAGGAAGCAACGCTCGAGCACTCTTTTccatgttgctgctgccagctccgTTCGCT
CGACGATTGAGAGATTTATTACTACCGGAACCACCGAGCGGGAGTAGCGGCGACTGTGTGGTGGGCGTCGGGTCATCCTGCGCTACTGGGGGCAACTTCG
CCCGATttcctccttgctgctgcgatttCAACGCGAGGACTGTGGTCGTTGTTGACTTTCGCTGAAGCAAGGACGACCCAGAAGCGGATCGACTCACTTT
CAAATCCAAAATGTCCCTGTTGTCTTGAGGAAGCGAAGAGCTTCGGCCTTTGACACAGCTGCTGCCCTCAGGAGAAGACAGTCGATCACCCGTTTGAGTT
TCATCAGGTTGTGACGCACTGCTGACACCCTCGTGGGTAttttgctgcgcttcagTGGGGCTTCCAGTCACTTGTCGTGCCGCTCCAGATACGCCAAACT
TCGCTGCCCCTCGTCGGCGCTCAAGCATGAGCGAGCCGGGATCGACTAGTGTGCGCGCGTCGTTAAGTGGCAGTAGCGGTGCAGACTGCGATTTTCCTAG
TATGGTACCATCGGCGCGGCCTCCAATCGACCCACGCGGTTGGTGTTGATTTTCAGCCATGACACTGCTGATGAAAGTCTTCTTGTACTTCTCCCACGCA
ACGGATTTGAGAGCACGACTCGGGATGGATTCGCGAATGTATCCGTTTGAGGAGCGCTGCAGACTCGCGCGAGCCTCTGCCGACATGAGGTGAAAGATGT
CAAACCGTGAAAGCACGAGAATTTTCATTGGTGACTCCGCCAGGATGGAGTATTCACGGATGAAAATGTCGTTGAATTTCCCAGCTGATGCCCTGCAAGC
AACAACACAAGTCAGTTTTACTTTACTTCGCTCCAGCGAGAGagataaaaaaaaaacgatATAATCCTTACTCCGCGCAGCCCAAAACCGAGTTGGGGCC
ATATCTTCCCAGCTCGTACACCTGGCACGCGTTCGTGATAGGGTGCTTTCCTTCATGGATGATTCGACATTCCCCTCGAGTTACGATAAATAGCTCGCTT
GCACGTGATCCCTACAGCAGCTCGGAACGTTGTTAGGAAGGATGCTCACTTCTCCTACATCTCATGGACTTCAGTAAAACCAACCTGCTTGCATATCTCG
CCCTTATAAGGAATATACTTCTCAGTCATAACCGAGCACATGCCTTCGATGGTGTTGTCATCCCACTCGGGGCCAATGAAGTACGGGTTCTTTCGCAGCA
TCTGTGCGTACTGTGCGTGATACTCGTTCTGGTACTTTTTAATCAATGGCCCGTACTCGTCACGGCCTAGCACCAGCAGTTCGCAGAACTCGGTACACAT
CACGGTGGCACGACGAACACCGTCTGCCTGGGACAGCGCCAATTCGCCAAAGTATTCGCCTTCGCTAAGCCTTGAGACGACACTCTCCTTTGTCTCTTCG
AAGCGATTTTTCGCGTGGACAGATACGTCCACACAGCCCGTAAAAATGATGTAAAAATGCCGACCCACTTGGCCTTCTGCGAAAAGCACCGTATTGGAGA
CGGCACTAACGAGCCGCATAACTTTGCAGAGTTGCTTTCGAACCTCGAACGAGAACCGCGAGAAGAATTTGACGCTTTTTAAATACTCGACGGCGAATTT
CAGATCCTTTTCGGATCGCTGAGCAGAGTTTCGCATGAAAATATTGCGCACGATGTCCTTGTTACTGCGGAATCGCTTGGTTATCTCGAGCGTATGGGAA
TTACTGGAGTCGTGTgactccttcagcagctcgctgaaCACGACACGGTTGATAAAAACAAACTCCGTTGGGGCACTTGAAGCAATCACAGATGCTAGGA
AAGATGGGCAGGTTAACACAACAATACGCTTTCGATCATGTGAGGTCAGCAGAAATATTACCTGCTCGTACGTCAGTGTTGGAAAGCAAAGCTCTCTCCC
CAAAGGTATCTCCTGGACCCAAGAAGGTTAAATGAATGGTTCCATTGGTGCGACCATGATTATCGATCCCATTTTTCACCACTTCCACTGCGCTCTCAAC
GCCATAACAACGTTTAGACAGAGGTATCTGATCTCATTGAAACACTGATGTGCCTACCTCGACCGGAGTAGACGAGGTAGAAGctgtcgccatcgtcacc
cTTTTGATAGCACAATTAGTACGCTAATCTCAGAGCCAAGAGGACTGCAATGGAGTACGCACCTCGTGGAAGACATACGTCCCCTTCTCAGCATATGCGA
CTATCTCGAGCGATTGATACAGTCggtccagctgcaccatcaTCACACGCGCAGCACCATTCCGTCAGCCAAAGCAATTCAAGAAGGCGCAAGACGGACA
AACTGAGCTCACCTTAACTGCAGGTGTACAATATGCCATGAGGAATGACCTGGTTAGCCAGCACCAACGTTGCTATCACTCTACTAGCGCCCAACGTACA
GGCATCCAGATTGgagaagaactcgagcaACTTGGACGACGCGAAGAGCGATTTGAGCTACGGGGTTATTTGCGACAAAGAGCGTCTTCAGCTAAGACCA
ATGCAGAGCGTCAGCCATTGGGTTCGTTCGACTCACCACGTGGATGTCCTCTAGCGTGCGCTTCCCCGTGGGTTTGTGCAGGATGGTGCGGCACACGTCC
ATCTGCGGACTCTTGTGCTCGATGGCCCGCAGGAaggcgccgtcgccggccatctcctccatctgcgaGGCCAGCGACTTGCGCC