Description :
From Genome Similarity Track
Location :
Scaffold_612:1854- 3732
Transcript NameFunction/comments
g13950.t1ETI44638.1 hypothetical protein F443_10675, partial [Phytophthora parasitica P1569

Sequence
1878 bases(100 bases per row)
AGATGCTGCAGCAGGAGCAGGTGGCCGTGAACGAGAAGAAGGGCATGTACGCTGACACCGACGCAGAGTCCAACGCCACGCTTAAGTGGCACGGCGCGGA
CGGTGCGGCGCTTGTGCACGAGTACAAGGGCAAGCTGGTACCGGCCATCGTCGAGGCCGTGAGGGACGGCGCGTCTCTGCGCGTGATCCTCAAGCCTTCG
CTGCAGATCATCAACTTCGGCCTGGCCGGAGTGCAGTGCCCAAGAGTGAATCCGCCCGTGAACGCGGCCACATCGGCTGAGGGAGAGGAGAGCGACGCTG
CGCCTGTCGGACCGGCGCCCCATGCGCGGGAGGCCAAGCACTTTACGGAGCTGCGTCTACTGCACCGCGACGTGGAGCTGAAGCTCGAGGGCGTGGACAA
GTACGGCAACCTGTTTGGCAGCGTCGTGCACCCGTCCGGACGCAACATTAGCGTGGAGCTGTTGAAGAACGGCCTGGGCCGCATGGCCGACTGGAGCTCG
TCGTTCACTAGCGCCTCGGCGCGTGCCTCTATGCGCACGGCGGAGAAGGAGGCCAAGCAGCAGAAGCTGCGCGTGTGGCGCGAGTACCAGGCGCCGGTCC
TGCAGTCGGACAAGCACCTGACGGGGACCGTCGTGGAGGTTATCAGTGGCGACTGCATTGTGGTGTACGTGCCGGACGCCTCCACTCCGGCCGAGCAGGA
GAAGCGGATCTACCTGAGCTCGCTGCGTGCCCCGCGCCTCGGCAATCCCCGTCGACAGGAGCCCAACGCTCCGTACGCCGTCGAGGCCAAGGAGTTCCTA
CGCCACCGCGCCATTGCCAAGACTGTGCACATTGAAGTGGAGTACGAGAAGCCCAGCCCCTCGGGCCAAGGCGACGTCATGATGTTCGCGTCCGTGTTCT
TGGACCCGTCGGCTAACGCGCTCAAGAAGAACCCGTCGGCCAAGGGCGCCAACCTGGCTATTGACATCGTGGCTGCTGGTCTGGCTGAGGTGGTGCGCCA
CCGCCCCGACGAGGAGAAGAGCGAGTACTACGATGACTTGGTGACGGCCGAAACGAAGGCCCAAACGCAGAAGAAGAACCTGCACTCCACGAAGGAGGCC
CCGGCCACCGAGCGTCGCGTGACTGACCTATGCTTTGATTCTACCAAGGCCAAGCAGTTCTTGCCTTTCCTGACTCGCGAGCGCTCGACCCGCGCTGTGG
TGGAGCACGTGTACTCGGCTACGCGTGTGAAGCTCTTTGTCCCCAAGGAGAACTGTATTCTGAACTTCGTGGTTGCCGGCATTAAGTGCCCGCAGCCTGC
CCGCCACGGCGCCCAGGGTGTGATTGTTGCGCCCGCTGAGCCTCTGGGTGAGGAGGCCAAGCTATTCACCAAGCGCAGCGTGATGCAGCGTGAGGTGATG
GTGGAGATTGAAGACATGGACCGTGGTGGCAATGCCTTTGGCCCTCTGTTCGTGGTGCCCAATGGTGGCGGCAAGCCTCTGCGCGACGACCAGCACAACT
TTGGCGTGCGTCTCCTGGAAGAGGGTCTGGCGTGGGTTGACTCATTCAGCGTGGAGCGCACGGCCCTCGGCAATGTCCTTCAGCGTGCTGAGGAGCGCGC
CAAGGCTCAGAAGAAGAAGTACTGGGCCACGCACGATGCCCAGGCACAGGCTAAGGCGGCACAGGCCAAGCAAGCGAAGACGAAGGACGATGTGATCCCG
CGTGTGAAGCTGTCGGAGATCGTGAATGGTCCCCACTTTTACATCCAGAACGTGGGTGACCGCAACTGTGCCGCCGTGGAGGAGAAGATGAAGGCATTCA
CGCGTACGCACGGACTTTCTGGCAAAACGTTTGAAGTGCGCCGCAATGCCGTGTGTGCTGCTCTATTCGATGACGGCA