Description :
From Genome Similarity Track
Location :
Scaffold_1163:1854- 3320
Sequence
1466 bases(100 bases per row)
ACTGCAGTGCCTCGCAGCGTATCAGTTCCCCTCGTTTCGAAAAACGAAAGCTTAAAGCAGGACTTCCGTCCTCAAAAACGATTTACTAGCTTGAAAGCTC
GCGTGAACCCTGCAAGGATGGATAAAGAGCAACAGGGACTGTCTAACTTTCATGTATCGGTAATATGAATAATACGTAGCTACATAATATAGTTGTGTAG
CCTATATGCATGAAAGAGATCTCAGCATAGCCCTGTTGCGATTGTCATAATATCTTTATAGTATAAACTTTATCCAATCGCTGAATCACATCTCGTTGTG
GTTTAGGTACAATACATTTAAAAAATAAAGCAAGGGTGAGTTAGCTAGAATTGCAATCGAGTCGGTCGGTCACTTGAGTTTGAGGCGGGgaattgaaaag
tgaacACTCCAGTGCGAAAGCGAATGCGAAAGCGAATGCGAATATGATGGGTGGTGGCGACTGTCGGATGCCATTCAACCGTCGAAGAGGATCACCGCCA
TGTGTGGTGTATGTACCGCTGTACAGTAGACGAGTCTCGCTGCTAACAACGCTAGCAACGGCttgacgttgcagcagagaCAGATCCGGAGCTGCTCTAT
CAGTGTCCTCGGCGCGTCATATACCCCATGAGCCTATCAGAGGCGTCTGAATTCGTAGACATATTTGCTGGTGCACAGCTCGTGAGGGAGAAAGGCGTCC
TGATTAAaaacgttgctgctccgctTGACACGTTTTGCACCGGAACCGCTTTGAGATGAGCACCAGAGAATGTTAAGACTTGCATCGATTAAATAGGCAG
TTGATTCATACGGGTTCTGTCAATACAGTCCAAGCACAGTATTAGCTCAAATGGTACTCAGCGCTCAAACGTGCAGCTTCGGTTAAGCTGAAGTTGAGTT
GCACTTTTTGCGGCATTTTATCCGCACTCCACGGCGATCATCTGTCACCCGTAAATTCAACAGTCTGCCTCGTTACCAAATTCTACTCTGTCGCAATCTT
TCAGCTTCGTGTTAGTTGAAGTTGGTAGCAGGAAGGCAGAGGAAGGCTTGTTTTGTTAGTCGAAATTTCCGAGATTTCCTCCCGAGGTTACTGGTGTGGT
TTGTCCACGTCTGCTTGGTCAGAACAGAAGTCGACTTTTATTCCTTCTATTAGATTCTGGAATGACCCTAATCGCTCATTCACTACTTTCAACTGTACTC
TACTTATAAATGCAGTCCTCGGCTACACGGCTCTTTACTGGCCTCCTTTAACCGGACTTCTTAATGCCTCTTGCCCATGTTGCAGTTTTTGAGAATGTCC
CTTGGTTTCACTGGTGCCTCACTGGTGCTCATGTTGTACAAGACTCTGTTACTCAGGTAACCTAAAGCTACTCAGCCTGCACTCCTCAGCTAACGAGAAT
CCATGAGAATCCCATGACTGTGGTCGTGGTGTGCTTCTGTCTGGGCTGCTACGTGACGTATACGTC