Description :
From Genome Similarity Track
Location :
contig_21:185393- 186475
Transcript NameFunction/comments
g4786.t1XP_008897974.1 AGC protein kinase [Phytophthora parasitica INRA-310

Sequence
1082 bases(100 bases per row)
TGACAAGTTCGAGCTCACGGAGGGCGGCGAGGTGCGCAGTCGCAGCTCCAGGCAGCGCATCTCCAAGCAGGAGATCCGCGAGCACGGCGAGGAGGTTCTA
CGTGGCCTCATTGACCACGTGCACACGAGGATGCTGCAGGAGTTGCTGTTCCTGGAGCAGGCCATCCCGCCACTTGAGTTCGAGCGCAGCTCCGTCGAGT
CCGGCTTCGACCCGGGCGCCAGCACCGCCGGCAGCACCAGCAGCTCAGTGCGGTCCAGCTCCTCCAGCATCTGCTCCACGAACGACGGGTTCCGCATGAT
GATCGACACTGACGAGCCGCGGTGCATCTTCCACACGAGCAAGAACTTCAGCGTGGCCGAGAAACTTCTCGTCTACGTGTGTTCCTTCAGGGGGTTAAGT
TGTGGCATCTGGAGCCGCAGTGTCTTGCTGAAGGACGGAGTGCAGGTGGGCTCCATGCTGCCGTACTTCCAGAAGGCCATTGCTGCGGGCTACGGCGTGT
TGGTCATGAACCCCAACATGAACACGCAGCTGATGGTGACTCCGGATGGAACGGTGGAGAAGATGCCGATTCGAGGATCCAGCAACGCCGACGATCACTG
CGACCACGTGTGGCGCAACTACATTTTCCCGTCGGCGGCGCACAAGGTGCACTTTATCGCGTATGGTTATGGAGGCGTGTTGGTGACGCAGCTGATTGCC
AAGTACCGCTACGAGCTCAAGAGCCGGCTGGGCAACGTTGCCTTCATCGAGAGCTCGCACAAGATCGACCCGTCCTGGAACTCGGGCTTCAAGCGGTTCT
TCTCGCAGCACAGCATCTCCTGGTCCCGGTCCGACTTCCCACTCAACACAGAGCTCAGTCGCGATGCTACGGCGTTTGCATCCAGTGGTGGCCCGAGCGG
CACGGGACCACGACTAGCAGTGACGATGCATTGTCGCCGTCATCTCGTTCACCAAAGAGCCCTAGCGCCGCGCAACTGACAGGATTCGGCTGCATCTGCC
TGTCTGCGGGTCCTTGTGAGGGCCCCAACGAGAGTCCTGCGTACACGACGAAGGCTGTTCTGGACACTGTGTTCGCGTTCCT