Description :
From Genome Similarity Track
Location :
contig_21:185362- 186444
Transcript NameFunction/comments
g4564.t1RAW40428.1 hypothetical protein PC110_g3405 [Phytophthora cactorum

Sequence
1082 bases(100 bases per row)
ACAAGTTCGAGCTCACGGAGGGCGGCGAGGTGCGCAGTCGCAGCTCCAGGCAGCGCATCTCCAAGCAGGAGATCCGCGAGCACGGCGAGGAGGTTCTACG
TGGCCTCATTGACCACGTGCACACGAGGATGCTGCAGGAGTTGCTGTTCCTGGAGCAGGCCATCCCGCCACTTGAGTTCGAGCGCAGCTCCGTCGAGTCC
GGCTTCGACCCGGGCGCCAGCACCGCCGGCAGCACCAGCAGCTCAGTGCGGTCCAGCTCCTCCAGCATCTGCTCCACGAACGACGGGTTCCGCATGATGA
TCGACACTGACGAGCCGCGGTGCATCTTCCACACGAGCAAGAACTTCAGCGTGGCCGAGAAACTCCTCGTCTACGTGTGTTCCTTCAGGGGGTTAAGTTG
TGGCATCTGGAGCCGCAGTGTCTTGCTGAAGGACGGAGTGCAGGTGGGCTCCATGCTGCCGTACTTCCAGAAGGCCATTGCTGCGGGCTACGGCGTGTTG
GTCATGAACCCCAACATGAACACGCAGCTGATGGTGACTCCGGATGGAACGGTGGAGAAGATGCCGATTCGAGGATCCAGCAACGCCGACGATCACTGCG
ACCACGTGTGGCGCAACTACATTTTCCCGTCGGCGGCGCACAAGGTGCACTTTATCGCGTATGGTTATGGAGGCGTGTTGGTGACGCAGCTGATTGCCAA
GTACCGCTACGAGCTCAAGAGCCGGCTGGGCAACGTTGCCTTCATCGAGAGCTCGCACAAGATCGACCCGTCCTGGAACTCGGGCTTCAAGCGGTTCTTC
TCGCAGCACAGCATCTCCTGGTCCCGGTCCGACTTCCCACTCAACACAGAGCTCAGTCGCGATGCTACGGCGTTTGCATCCAGTGGTGGCCCGAGCGGCA
CGGGACCGCGACTAGCAGTGACGATGCATTGTCGCCGTCATCTCGTTCACCAAAGAGCCCTAGCGCCGCGCAACTGACAGGATTCGGCTGCATCTGCCTG
TCTGCGGGTCCTTGTGAGGGCCCCAACGAGAGTCCTGCGTACACGACGAAGGCTGTTCTGGACACTGTGTTCGCGTTCCTTG