Description :
From Genome Similarity Track
Location :
Scaffold_3:185355- 186464
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_01296prespore-specific protein
Sappa_CBS223.65SPRG_01297mitogen-activated protein kinase kinase kinase 11

Sequence
1109 bases(100 bases per row)
GGCCCGCAGCACGTCACGAACGCTTTGCGCCACTGCTCAAAGGACCCTGAATCGTACGTTGCGAGGTAGTAGGACTTGGGCTTCTTGGCGCCGGCAACAA
CGATGTGGAAGGTGAGCGCAGACGACGCGACGCGGCGCACGGAGAGCAGTCGGCGCGTCTGCTTGAAGCCACCGGCGAACGTGTCTTCCGAGTCGTATTC
GTACAGCGAGGTGTCCTTGAGGACGAAGAAGCGGCGTCGCCAGAGGCTCATGAGCCCCGAGACGCTCTTGAGGCGCAGCCAACCGCTGATCGTGGGCATT
TTCTGGGGCGGTTGTACGGTACGGATGTGCGAATGAGCAACTGCACTGACCACATGCGCCGATGGTGTCACACCCCTTGTGCCTCTCGTGCTGCCACGTA
CGGTTCGCGTCCGTTGTTTGAAGCACACATCACGTACAGTACGTACATTCCGTACATGAGGTCAATGGACGATGTACGCTCGCGGGCTGTTCCAAGTACA
ACGTCCATCATGGCGCCGGACAGGCCGTCGCGACAGGCGACTCAGAAAGATCGCGATGCGGGCAGTAACAGCGCCTTGGTAAAGAGCCGCGACGCGAGAA
GAACGCATTACGGCCAGACGTCCATGCACCACGCGGGCGTACAGTCCAATGCACCGGTATAAATCTTACCAAGGGCGCGTCCGGCGGAGTATCCGCCTTT
CGGTCTGGGAGGGTTGATTAAATCCCCCGGCTCGAGCCGATATTATCCCATCCATCCATGGGTACTCGATCCATCATCCTGATGATGAGTACGCTCGTAC
GTGGGCGTCGTGACCGTGCATCCCACCGTGCCATCGCAACATCGGTCTGATCCGCCACGTGGTGGTGGGCGTAGAAAGGGCGCATCGATGGTTGACATGT
ATACTGGAGTGGAATAAATATTAGCGACATCACGGCAAGATAGCGGCCTACGACTGCTGCATGGCGTCGCGGTTGACCATGCGCACATGCTGCATGCAGA
GGCCGCCGACGCGAGCAAAGTCGTTGCAGTTGGCGACGCGGCAGCGCGACCCGCCGCCGTGGAGCCGGCAAAAGCCGCGGGTTTGGGCCGCAGTCTCGCA
GCCGTCGAT