Description :
From Genome Similarity Track
Location :
contig_48:185350- 186878
Transcript NameFunction/comments
g8373.t1hypothetical protein

Sequence
1528 bases(100 bases per row)
TTTGTATCTGCTTGGCGTGGACTTTGTGGCTGATTGTACTGAACGTCGCCCCTAACGAGACCGTGAACCGCGTCATGAACACGGAGACCTTCGACTACGG
GTCGTTCTGGCTCATGATTAAACCATCCGCAGCTTTGTCGGGAGTTACCACGTTTGGCCTCTCAGTCGTCGCTCTGGGATACCTCGCGGTTCTGATCAAG
ATGCTCGTTTCTCGTCGACTCGACTCGAAACGAGCCTACGTCATCAACAATTCCGGAAAGAGAGTTCATTTCGCTGGCAAGGTCGAGACGGTGCTCAATG
GCGCGGATGAAAAGCACAAAGGCGGGAAAATGGTTTCCACGGCGGTGAATTTTGCGGCTTCTCTGGCTCAAGAAGATAGCACGGCGAGGAAATACGTTGT
AAGTTCAATGTGGGCAATATGTTCTGGTGGGTATACTAATAATGCGATCGTCTGCAGAAACTCGGCTTGAAATTTGGAGACTTGGCGCTGGAAACAGTTC
TCCTCTATCAAATGCTCGAAGCTGGGTCACCTGCGCCACTGATCGGCGTCTTTACGGCGATCGTCGCGTCGAACGCCTTATCTTGTGCGGCTCTGATGTT
CGTCCCGTACGAGACAGCACCACTTGCGGAGACCCTCATCGACATTATGTACGTCGCACTTTTTCACTAGTGTCTTTCGAGTCTCTAACCTGATTTTTCA
ACCAGGTTTGACTTTCTCATCGGTGTGGGTTGCCCCATGCTCGTCCTTTCGTACTGCCTCTCCACGTTCACGTTCGATCGTGCCAAATTTGCCATCAACT
TGGCCGTTTTCCCTGCCGGGTGGTTTGAGCAGGGAGCTAGCGTTATCGCAGACCCCGTGGAGACCGCTGTGATCTACAAGAATCTCAAGTCTCTCCGGAT
CATGTCCGCGCTGGACTTTTTCACGCGTATGGGCATCAATTTGACTTTGTGCTACCGACTCCGCAACGTCGTGGAACTCATCAAGGACCCGAAAAAGCAG
CAGAGCAGCGTCTACCCGAAGCGCCATCGTCTGTCAGTGTGCGCTTTTGTGGGGTTCGCAGTGTTTTTGTGGTGTTTGTCGAGGAGAGCATGCGGACGTC
TGATGTGGCATGCCACCCGCACCCGGAGTGCGTCGTAAAAGCACGGAGATGGACTAGCCTGAAGACGGACTCCTTAACCCAGTGTCCATGCATCATAATG
ATTGACCGAGACATTGCGCCTAAAACCTACGAGGAGTGGGAGAACCCAACCAACGTGACCGACAAAGTGGCCCAACTTGCTGCGATGGGAGATCTTCAGA
CAATTCAGTTGACGAACCGCTACATTCCAGTTTTTCCGGACGAACTGCGTCGCTGCACGAACTTGAGGCATCTGTATGAGGCTATTTAGTTCCTGGCTTC
TGTTTGGTTTGACCGCTAAGCTGACATTTCTTTTGGCTGCACTCTTTACCCAGGTCACTGGAGTACACTCACACGCAAACATTTCCCGACTGGGTTAGCG
AGTTTAAGAAACTCGAGTTCTTGTACGT