Description :
From Genome Similarity Track
Location :
Scaffold_323:1853- 3698
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_323-fgenesh-gene-0.2Hsp70

Sequence
1845 bases(100 bases per row)
CTCGTGGTCCCACTTTTCGTAGGCCTGCACGACCAGCAGCACGGCACGGTGGGTCTTCTTCTTGATCTGCTTGACCTTTTCGATTGGTTCCTCTTCCTCC
TTCTTCTCCTCCTCCTTCTCGTCCTTCTTCTCGTCCTCCTTCTCTTCGTCCTCGGCACCGTCCTCCTTCTTCGCATCCTTCTTCTTGTCCTTCTTGGCGT
CCTTCTTCTTCTCCTTCTTGACCTCCACCTCGACCTCGTACTCTTCCTCGAGCGTCGCCTCGGCCTTGGCGATCTTCGTAACGCCGCTGCCGTCCAATTC
AAACGTCAGCGAGACCTTGGGCTCGCCCAAGTTCTTGTCGGCAAACTTGGCGGCAAACTCTTCAATGCCCGTGATGTTGAACTTGGCAATGTGGCTGCTC
GCACCCACGGGCAGCGAGGACGGCTTATCGTAACGGAACGTGGCCGAGATGTCTTTCGAGTGCAAGAACGACACGGCCTTGCGGAGACCCAGCTTGCTCG
ACTCGGTAAACAGCGACGCACGCTTTACCCAGTGCTTGTCACTGTCATCCGATCCCGCGTGGTCGATATCCACGAGGCGCACGCCGACGGCGTACGGCGC
AATGTCCGTCATGCCGACGTGGCGCACGCGGAACGAGTTGCTGAGGTTGGCGGCATGGAACGCGGCGCCCAGTGCCATGGCCTCGTCACCGTTCAAGTGC
ACACCCAGGTCTTTACCCTCGAAAAAGTCCTTGAGCTGCTGCTGGATCTTGGGCATGCGCACACCGCCACCAATGATCTCAATCTCGTGAATGTCGTCCT
TTTTGAGCCCGGCCTTCTCCAGTGCCTGCTCGACTGGCTTCATGGCCTGCGCAAAGAGGTCCTTGCAAATCTCCTCGAGCTTGCTGCGCGTCATGGACGT
GAAGAAGTCCACGTCCTTGTACAGCGACTGCATGACGACGGGGATCTGCTCGTTCGCACTCAGCACGATCTTGGTCTTCTTGGCTTGCGCGCGGATCTTG
GCCATGGGGCGAGGCAGCTGGCGCACGTCCTCACCGAGCTTTTCGCTGAACTCGGCTGCGAGGTGCTCAGCGAGCCGCAAGTCGAACTTCGCGCCACCGA
GCGACGCGTCCCAGGCCTTGCTCAGCACTTCAAAGCCCGAGACCGTCTTGTTCTTCTTGAAGCCATCAGGCACGACCTGGCTGCTGAACTCGGCGATCGA
GACCTGCAGCGAGGTCGAGCCCAAGTTGTAGAAGAGCACACGGCGCGGCTCGGCAAACGTCGAGTGCACCGCGAGCTGCAGCGCGGCGGCCGTGTTCTCG
TTGAGCAGCGACAGCGCGCGCACGCCCGAGATCTCGGCAGCGTCGAGCATGGCCTGGCGCTGGGCCTGCGTGAAGAAATCCGGGACCGTGACGACCCAGT
CTTTCACGGGCACCTCGGCAAACGCATCCGTGATGTGGCGCGCGTGCGTAAACACCATGGCGACCAGTTCTTCGGCCGAAAAGACTTGGCCCTTGTCGTG
CTTGAGCGCGACCGTGCCGCGCGTGTCGTTGTGGAGCAGTTCGTAGGGAAAGTACTCGTCCTGGATCAGCGCCGAGATCGCCGGGTCTTCCTTGGTCGTG
CCCAAGAAGCGGCGGATCTGCGCGTAGCAGGTCTGCGGCCGGCGCACGCCGACAGTCGCGGCGTCTGCGCCATACAAGCGCTCTTCGCCGTCGAACGCGA
CCATGGTCTCGGTCTTGCGCTTGCTGTGGACGTTGGTCACAATCTCGAAGGGCGTGCCGGGCTTGACGAGCGCGATCTTGAAGAACTCGCCGCCAAAGTC
GACGCCCGCGACGCTCGCGGCCACGGGGGACGGCCCCATGGAGAG