Description :
From Genome Similarity Track
Location :
Scaffold_25:185287- 190152
Transcript NameFunction/comments
Phyra_77535phosphatidylinositol4phosphate5kinase (PiPIPKD10) putative

Sequence
4865 bases(100 bases per row)
CCACGCGGGTATCCTTCACGCGGTCGTCGGTTGTTGGTGATCGGGTCTTGGGGTAAGTCGATCACGTGGGGGGTGTCCTTTGGATGTGCTGTTATAGCCC
TTTCCGTTGTTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGACTATACGATCGCACCCTGGCCAAGCTATCGAGGTTCGCAACGTGTCCTTGG
TTGACTGGGTGAGTCCTTCTTCGGGTAGGCCAACGTAGTTCCTTCCCCGGGATGTGTGGACGACACTTGTGTCTTGCAAGGCAAATCAGAATCTATTTAA
GCAAAGGTAAAAGTCCTAAAGATCTCTCTCCCTATCCCCATCCCGCTTGCGTGCCCACCGATTGCACATCACACTTGAACTTCCATCTGTATATCTTGAC
CTCGTATCGGAATGACAGTAACATTGTACCCAGCATCCATCCAATCCAACTGTACCACTGTGGCGGTACCATGTCGATCTGATCAGGTGAGTCCAGATGA
TCGCGGATGCCCAGATGATTGCAGATGTCTGGTTGATCGCAAGTGTCCGGATGATCGACTGTACCGAAAGGGTGGTACCAGACAGATAAAATTACCTGTA
CCATCGTTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACATATCCGGCACCAACCCCAACCCTTCTGGTCCAATCAGTCCAGACGCGATCTCTTCCCA
TCATCGGCAATTTGACCCAGGTCGCTTCACCTCAGTCTCAAGCAGCATAAAAGGAATTTTTGTTTCTAAAACAGCTAGTTATGGCTCATTTCGTCATCAA
CAAGTAAGCTCCAACGGAATCATACACGCGTCAAACGATCACATATCGCGTCAAGATTACTCGGTTAGGTCTCGTCACGGCTTCTACTCATCTAAAACGC
TAATAACAGGCGCTAGATAAGACGGCTCAGCAATACCAGGTGAAGTACGCTTGAACTGTGGGGCAATCATGCATGCTACCAGAGTATACACTGTGCTTCT
GTCTACACCATATTGGCCCCGATGCGCTCTGTTGAACAGCTGAGGGAAATTCATTTCAAGTGCATTTTGGATTGCGGCCTTCATTTCCCAAGTTGTGCAT
TGTTACTACTTGCTCTTGATACCGACACGACGTCCGCAGGGAGCATTAGGGTCCCTCAATGATTTGTATAGCTCGAAAGATCTCTGTAGATCAGGATCAA
TATGCACGTTGCTTTCGTTGATAACCACGACCGTCAAGCACTGGCGAACGAAGTTCTGCTCCAATCAAGGAGTGTGTGTCTTTATGGGGTAGGAGGGAGT
GTAATGGGGCCACGCTGACCTACACCGTTGCCGAGCAAAAGAACTTATGAAAGGGGGAGACCCATTGTTCTTCGGTGTGGTTCACACTGGTCACCTTAAG
TACGAGTACGTACTTCACACGAGTTGGTGTGTGGCACTCGGCAGCACGTTAAGTACGATGGTGTACATCACACAAGGTACGGAGTCGGACTTACCGTAGC
GGATCAAACGGGGGCCACCCATTTGGAAGATCGTCAGTTTAGACAGGAGTTCAGTATGCAGATAGTTTACAGTAGTTAGAACCTTACAAGTGAGATTAAT
ACAGACAGTTTAACTCTAACCTGGAAGTTCGCAAGTCGTTTGGTACTCGGTACCCGGAAACGACTGGAAGGCAAGCTTACAACAGAGACGCCAGGCGTCT
GTGTGGTTAGCGCGTTAACGCTTCCTCTAAGGCTAAGGTGCGTGTGACCCCCGTCACAGGGAGGGGGTCCTTCGTCTCACAATCGCGCAACATAGATGTT
CAACAGCGTGTAGATATCTAGCAATCCAAGGTTCAAGTCCAAGAGGATACGTTCAAATGACAGCAACATCTTCCCCTCGCCTGTCAAGAATGCACCCAGT
GACGTCTTCACAGCTAGACAGCTGCTGTTCTTCTTGTCCTTCACACGCTCCACGGCGTCGTGACTCTTGTTGGGACATGGCTCTCCTGGATGGAGGTCCG
TATCATGATCTACGTCGCCATCGTCGAGGTCATCCTCGTTCTCTGAGTCCGTGCACACGACTTCATTGCCGTTCCCGCCGCTCTTCGTGTCTTCAAATGG
TTGGCGCTGGAGCGCTGGAGCTTGTAGACTAGCCAGTGCGCTTGCCAGAGCGAAGTGGAAAATGAAAGCTGTTGCACCAGCGAAGCCTCGGGCGTACCCA
ACAGCACCTCCGAAATGCTAGTGGCTGCGGATGCTGGATTCAATGATGAAGTGCGTACTGGCTGCAGGACCATGCATGTGGCCAGTAATGTGATTTGAGC
TGGGAGGCAATTGAATAGGTGGTGTACAATATGACTGGTAGTGCAGTTAGACTTGAGAGCTGCACGGACAGACCTTGCCATGTCTGGACTGCGCAGCAGT
TCTCACTTTTGCTTTTGGTCAATACACTACGGCAAGAAATTCAAGGCCAGCTCTTCTCGCTCGTGCTCTACACTTTCCAACATTTTGTAAAGTACACAAA
CGTTCAATAGCCGACGTATCGGATTTCTGACTTGTTGTACCCTCGATTAAAATTAACAATAGGGCAGAGACGTCTCTACGGCTTTATTGGAGCTGGATGG
GCAACGCCTCGGACGGCGCCGCAGCTCCCCGCCCACTACCCGAATCTCCTGCATCCGACGCTCGCATGGGGCACCCGCCGCCCGCCTCCGAGAGCGACGC
GCTGCTGCGTGGCAGAGACCAGTTGCGTGCTTTTCCTACCGTCTCCCCACCTCGTCTGCCATTGCGCTAATCGAACGTCTTCCTCGTGTGCTCTGCAGTG
GCTCCTTCTGCTCCATCTCCTTGTCCAGCGACCCCTTCGAGAAGAATTTCAAGTCGCGCGTCATCCGGCAGAAAACGGGGCGAAGACGTGTACGCCACGG
AGCGGGGCTCTTGGCCCTGTGCAGCTGCTTCAAAGTGCTCGTGAAGGGTCCGTGCTCCGCCCTCGTCGTTGCAATTGCCGGTCTCTTGGTGCTCGTTGGC
GTCGCCTGCTCCACTATTGCTCTGGTGGGCAGCTACAGTGCTGACGAGTATTTGTTCCTGGGGGCGATCGCTTCTGGGGCCTTCACGCTCGTCATCATCG
TCTCGTTCCTCATGAGTCCGGCCGTGCGGGCACACCCGAACCCTCTTATCTTTAGTAAAAGTCTGGTGGATCTGCTGCTGGCCTTGATCTATATTGGCGA
GTACTGTGTGACGGAGTTCTCGGACTCGGTGCCGCTCCCGTTCCGGATCGCAGCGATCACGCAGGCGCTGCTCATTGCGGGCGAGTTCTGGTTCTTTGCT
ATTCCGATCGACATGGTGCAGTCCATCACGAACCCCTTCACGTCGTACGCGCACAATTTCCGCGTGTATTGGTTCTACTCGGTGCTAAGCGGCGTTATTT
GCGGATTTGTGCTGTGGTCGCTTGGGGACGCGGAGGCGGAGTGCATCGAGACAAACGACCCGAGCCCTGACTGCGCCAAGGCTACTAGTGATATTGACCA
GCGGTTCATCTGGTTCCACCACAACACCGACATGCCGGGCTTCTTCTGGCACCAGTGGATTCTGTACCACGTGTGTGTCGTGGTTTATCTGCTGTTCGGT
GTGGCATGCATGGTATACGTTCGTAGCCGGTTGCGTCGTGGACTGGAGGAGACTTTTGAGGTGCGGCGCCGCGTGCTGTCAAACGGCATGCTCACGTGTG
CGGTGTTCATATCGTGGTCTTTCCTGATGATCTGCCTGTTTGCGATGACGAACACGGCGACGATCAAGACTTTATTCGGGAAGTCGCTTTTCAAGGAGTT
GATTGACCTGAGTGCGTTTCTCCACGCTTCCCGCGGATGTGTAAACATTATCGTTTGGATTGTGGTCAACGCGCCCTATTTTCCTACGGCATACCCCGAA
GACCCAGCCGAGTCTGCACTGCAGTCTCCGTACGGGAATGGGTTGACGATGAGGGGGTCATACTCTCCTTCTGGTAACAGTTCTGAGTGCACTGATACCA
GCGATGTTAAGAACAATCCCCACAAACATGAAGAAAAACTTATGAACCCCCAGCTGAATGTGGCGTTGCGGAAGCAGATGATTCACATGGCAACGAATGG
AATCATTGAATCTGTTCAGCACCACCACCGCATGCGGCGAGAAATGGGAAATAATCACACGTTCCAACTTGATTGGCAGCGATCTCCTCAGCGGCGCATC
AGACAGTTGGTGTCCTCGGTCTCAATTAGTGACGACGTCGGATCAATGGCGAGTCCCCCAAAGTCCATGCCAATTTTGCGCGAGATGAGGAACTCGACTA
TCCGAGTCGTAGAAGAACCGCGGGACAACCCAAGCAACATGCGCTTCACGTTCATGCCCATGGCCCTGAATGAAATGCAGTTCTACGATTTCCAACCGCG
TGTGTTCGCATCTATTCGTCAGCTGTACGGAGTTAATGATGCTGAGTACATCTTCGCTTTCCGCAGTACGATAAACGAACGCATCAGTGAAGGCCGAAGT
GGTGCCTTCGTTTTCAACACGTGTGACCGCAAATATTTGGTGAAGAGTACGACTTCAAAGGAAAAAGACGTGCTGCTCCGACTCCTGCCTAGTTATTTGC
GCTATATCAAGTGGAATCCTGGCACGCTACTGCCTCGCTTCTTTGGCTTTCACGCGATGAAGGTGTACGGCCAGATCTTCTACTTCATCGTGATGGGGAA
CTTCTTAAGCACAACGGAAGTGATTCATCGCAGATATGACATTAAAGGGTCATGGGAAGACCGAAATGCTCCCGCCTGCGTTTTGGGCGAGAAGTACCGA
TGCTCGAAGTGCAACAGGTTCTTCACGTTTGGCGGCGCTCCTGACGAGCCGTGCTTTTTACCGGG