Description :
From Genome Similarity Track
Location :
Scaffold_355:18524- 20492
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_355-snap-gene-0.16Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_355-snap-gene-0.17Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_355-snap-gene-0.18Transmembrane protein

Sequence
1968 bases(100 bases per row)
GTGATCCGATCCAAGCGCAGATGCTGCACGAGTACAACGCACTGAACAGCGAGATCATACTGAACGAGCAAGTCGTGAACGACTCGCTCAAGCTCGTGCA
GGTGACGATGCTTACGGACATGACCAGTGCAATGGAAGAGCTCGAGCAGATTGAGCAAATCAAGACTTCGATCCGGGACGAGATGGCCAACCGTGACGCT
GCGTTGGCGGTGCTAATCGCANNNNNNNNNNNNNNNNGTGGCGGTCACGACCACAGGAACTAGAGTCTCGGATGGAGCAGTACGGGACGCTGAACATCGC
CCACGTGCATCGTGCGAGCCACGAGAAATGCGCCATGCTGGCGTCACAGATCAAGGACAAGCAAGCGAGCGTCGCGCGTGTCAAGACGATACTGGACACC
GAGGTTGTGTCCGTTAGCACAGGCGATGGCGATGCTGCGCGTATCGACAAGCTAAGCGCGCTGAGGACTCAACTCGCGCAGGCTGAGCAGGCCGTTGTGG
CGTTGGAGTGCAAGCAGTTGAGCGAGTTTATGCGGCTGTTCCAGTTCAGTCACAACATTCGCACGCTCTGCCAGACTGCCATGACGGCAAATCTAGTGTC
CACGTAATAGTTCGATTTGGAGTTTCTACCCTGTGAGTCCGCGACATGACTGAAGCTGCTGCAATCACGGCTTACCAGAGAGATGTTGTGTATTCTACAC
GTGCCTTGAGATCCACCGCAAAAGAGGATTCCGAGTGAGCGACTGCTTTCCTTTTCTATTGGATACTACATCATCATTGGTGGTGCTCGTGGGCTTTGTG
CACTCCAGCGGGTGTTGCATCTATCGCATCCGAGACCAAAGCACAAGCATGGCAACAAAGTTGACTTTTTCCTATTTACAACGCGAGGGATGTGCAGCGT
GTGCATGCACCAAAGCATTAATCAGTGGCACTTGGTGACCAAAATGACACGGATGAACGGAGATCCGTGGTGGCAACAACGACGTGTCTCAGTTTCATCT
ACAGGTCGACTGCTTCGGTGTAATCAAATACAAAGACTAGATGCTGCAAACGGTGCGTTTTGACACGCAGACCTCCGTCCATTAGTCCAAAGCTCTCTGG
TGTCGCGGAACTAAATATATTCCCTTTGCCTGTTCTGCTCTAGAGCGAGCACTTGGCACCAGTGACGGACATGACCAAGACCATCTACGTCAGACAGATC
GGGCCGGTGCCAGCCTCGATTCGGCGGCAAGTTCGGAGGAACCGTGTTGACCTCACGGCCGTCGTGCTCATCGTACTCTACAACTGGGCGCTTTGGGGCT
TCGTGTCCCTTCTCGTGCTCTCGGAGATCTCGGGCGTCGTCTGGGACACGACCACGCCCTGCTTCGACGTGCGGTACGGTCCGAGTCCACTGCTTGGCAC
GTATGCAATCTCGGGCACGAACGACGAGCCGTACAGCGATCGGATGCTCGTGTAACGGCTGCACAGACGCATGTGCATGCCAGCGCAGCTCAGCGCCGTG
CTCCAGGAGCCAACCACGCTGCGTATCAACTCGAACGCGACGAACGGGTCCACTGGCTACGTCCATGGATACCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCCACGAGATCCAGTTGGAAGCTCACGTCGCGGCGTTTTACACGAACACGTGCGAGATGCTCGCGGTCACGCTGGACGCCATCTTCGATGCGTGCGTGG
CGCTTGGGTACAGCGTCACGCGTGATGCAGCGCTGCGCATCGTCGACGGCGTCGCCAACGACGATGTCTCGCTGATCCTGACCGCGTTGCCCGTGCTCGT
AATGCCGTACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCAGCGCGTGCGCATT
CCAGTTGAGCGGCAAGTACGATTCCCAGACGCACGCTGTCGCATTTTTCTACAGTGTTGACCGCGAAC