Description :
From Genome Similarity Track
Location :
Scaffold_95:185230- 186233
Transcript NameFunction/comments
g13498.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CACGGGGAACCGAGAACTTGGCATACTGGTGAGCCACAGCCTAAACTCCTCGTGCATCTCCTCCGTCGCTGATTGCTCCAAGATCTGCTCAAGCCGTCCT
AGCCATGATACAGCCAAATGACAGTTTTGCAGACACACCCAATCACCCGTCTGTTTAGCTTGTTTCATGAGAGCTTCAGCAATCGGGCCTTGGCCTTGCC
CAAGCGAGATAATCTTCAGACCAGCTCCATCTTTGCCTTCTTGTTTGGCGAGCTCCAAAAGGTAGTCGTTGATATCGGCGCCCGGTGAAAGTACGAAGAT
CAGCGGTGTCTCCGGCTTTGAGTCTCGATAACAGCCTCCAAGATCGAACGGTGGAGACTCGGTGAAGAATTTGCCCAGCTCACGTCCGACGAACTCGCGC
GTTCCAAAGACGAGCATTTCCTCTCGGAAGACGCGCAAGATTAGCAGCTTTTGGAAGTTCGTAAGCGTCGATTCCCAGGGTTCCGGTAGTGCTTCGGCAT
GCGGTAAGTCGGCCAGAACCATTGCACGTTTCCACTCCGTTGCGTGCTGTCCAACGGACGAGGCCAGGTCAGTAAATGCCGGAGAAGTATCCTTCATACC
AACGACAGTCTTCCACACCCTGTCAGACAGCCAAGACGGACGCGTAAGACCACACGATTCAGCCTGTGCGGCTTGAACGGCTGAACTTCTCTTATCGCCC
ACCAGGTAAAAGTTCCATTCGCTGGAAGAGATCGCCCCGCGATGTAAAAGAATACTTGATGCGATCATAAACGCGTAAATAATCTTGTCTTTCTCGAACA
GCCCGCGACAAACGTTTACAAACATGGATACGGTGATATCCTGCATGAGAATCTCCAAACGTTCTTCCAGCACTTCGGACTTGGTCGAGTTTTGAAGCCG
CATCACGAATAGCTTCTGGTAGAACTGCAGCGAATACTGGTACATGGGGTCCACAAGCGCAAGATTCGCGATTGCGAAGTAGATAATCGATCCACGTACA
GCA