Description :
From Genome Similarity Track
Location :
Scaffold_332:18523- 20853
Transcript NameFunction/comments
Phypl_g7079hypothetical protein

Sequence
2330 bases(100 bases per row)
CGAAGCACACGTAGGGCTGACTGCTGTACAACCGCGGAGTTGCTACCCAGGAAGGTCCCCCAGATTAACCTCATCCACTTGGGAAACTGGGACGTGAAGT
GAACGAGTCCTTCGGACGATGAACTGAGCAGGATGACCAAAGCGTGTAGCTCCACGAGTTTGGACTGCTCGTTGGCACCCCAAGCGACCCCGGACGGAga
cttcttctcgtcgaaTACGATTCGAACGTGGATTGGAGACAAGGAGCGATTGTGGAAGCGGAAGTGGCTCAGCCAGCCGTCAAAGCACCGGAAACATCCT
GTCTTCTGCTCGGAAGCATTGTTGGAGGGGGTCATCCCTGCACCATTCATGATTCCGAGTGAGCGCGACAGAAACTCAATAGCTAACGAGACGGAAGAGC
TGGTAGCTGTCGGCTCGAACGCTGTCGGGAAGCGACCAAAGTGAAGCGGGAGATCCACGTTACCAGCGGCCCATATCGGAACGCTCTGCGCAGCGAGAGA
GCGCTGACAGTCGAGGACGCCGTTCAAATACAGCCGAAGCTTGGTCGCTTCCAacacgacggccacgtggATCCACGAGCCTCCAGCTACAGATTGTTtc
gacagcacgcgctcccaCACACGGCCCCTTACCGAGAActcagcggcgccagcttctcgatcCAAGTCCATGAGAATCCCCACTTCCAGCTGCCAGTTGT
CGCTACTTTCAggcacgagcacgacgtaGAGCGATATCTcgcgcccagcgccacgcacgagcaccagctgcCGGTCTTGGAGGCCCGGAGTCAAGTCGAA
CAGGTCGCCGTCCATTGTTTgagagcgcggcgccggcgaaCAGTTGATAAACAGCCATGCCGTGACACTAAATTCATTCGGTTTGGTCAAAGGAGACATG
GGCGTGGTCGGCTCACATCCGGAAGGGGAGATCATGGCGTCGTAGCTGAAAGTGGCCCCTCTACTCTGTGGGGAAAACCTGTGGGGCAGCGTGATGGCCT
CAAAACTTCTTCGAACCCCCGCCACCGGATCGGCACGAGTTGATTCAACGGCATTCCCGTCGTCGGAAGCTAGCAGAGGCAGGAACCGGTTGGAGATCCA
AGCTGCTTCGTTGTACAGCAGCTCGGTGACATCAGCCAAAACTGGGAACGTGGGTACGTCCACATCTCGTCCACTGGCTGCCTCGCCGTGGACGGTTTGC
ACCGCAAAGTGCACGCAAATGAACCGAAACACAACCCACAGTGCGTCCTCCAAGCGAgaaagctgctgtcgcgtAGCGAATTGATTCAGCGTTTGCTGTC
CTGCGCTTCTGCCCACGATACTGTCCACCGATGGGATCGACGGAGACGCGTCGGCGCTTGTGTCGCAGCCACCGCTTTGACTCGAAAGCCCGTGCAGCAT
TTCTTGGATCACGCGCAGAATTCCGATTTCACTCACGAATTCGAATTGTTCAGTGCTGAAGTGGACCCCCCAGGCactgagcagcacgatgacGACCCAG
AACGAGGAGGTAGCGTCCGACGCCATCATTAAGGCAGCTTTGTCGGTCATCATCTCCGTCACCTGGCCGAGAAACTCGGAGAAAGCTTCGTTCTGGAgac
tggagaagaagaatCCGAGGCTACGAGAGCCCGCGAGGATCGAGggacaagaagcagaggATTTGGACACAAACACGTGCGAAACCTGGTGAACGATGTC
CGCTTGAACCGAATCGAAGGAGACCAAAGTGACAAGTTCCCACAACGCTTCCAGCCCGCGGACTGAGCAGCTAACGCGCCGACAGGGATCCACGAGGAGC
GTTTTGATCGCATTCTTCGACGCCACCGGCTCATCCGACGTAACGTAGGCCAGAACTTCCTGCGAGACTCCGTCTTGTCGCTCGGGTCGAAACTCCGCAG
CAACGAACTTCCACCGCGTCATCGTGTGGAGCAGCGTTCGCACTCTCCTCCACTTCGACGAAGGGAACGCCGCCAGGAACGGCAGCTTCCCGTCGCTATA
CGTcgcgtggaggtggcgcttAGCGGACGAAGCACCGAACgtgaaggacgagctggcagATACGAGGAACGCGGGGTCGTACGGTGCGATGTAGCCCGCA
TCCAACTGCAGATTCAAGTGTTCTTGCTCGTCGTGCACGTCaacaaggagcaggagctcacACCGATCCAGAATCGTCTGCTGGAGAGCCGCAATCCTCC
CTAGGGGGCTCTCGGAGTCTGCGTGGGGCGTGTTCTTGATCTCAGTCTTCTTGACAgcgacgcgccgccgcaacTGAGCAACGCACTGCCACAAACGGAT
AAACGCTCGTGGCGAAGACGACCGCTGTTC