Description :
From Genome Similarity Track
Location :
Scaffold_425:18522- 19771
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_425-fgenesh-gene-0.2UPF0171 family protein
Pytir_DAOMBR486maker-pir_contig_425-snap-gene-0.15GL24937

Sequence
1249 bases(100 bases per row)
TGGAGGAGATCATGTGGCGCGAGAATGTCTCGCGCAGCGAGCTGCGCACCGTACTCAGCACCTACCAGGACATCATTGTCTGTTGTCTGCACGAGTGAGC
TGAGTGAGCGAGAAATCCATTGTTGAAGTAAGTATGAGGTGAAGAAAAGGTTTGACCCCAGGGTACTTGGTTTGTATTAAAATTGGTTGGGAGGAAATAA
TGATTGGTGGTGGCGGCGGTGGGGGTCGGCTGTCGTGCTTCTTACTCGGCAGCTACTGCTTTCTTTGTTCGGAGCGTGTCGATCACCTCAAGGATCGTCT
TACGGAAGCCCTCCTGCTCCAGCAGAATACCCGTCACGTGACCGGTCTTCAAGTACCGGAACTGCGCAGGTTTCCACTTGGTACGCATGCGCTAGATATT
GATACGAACAGACACAGAATCGGCGTTAGTCCTAACCCGCCACTCACATTGCGACAACACTAATGCCTTCAAGTCATTCACTACCTGCCACTGCGCCTCG
GTGACGCCAATGTACTCGTCCTCCGTGCCGACGACAAACACAACGGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAAGTTGTCGATGTCCGTG
ATCGAGAGGAACATGCGCATGCGCTTCTTAGCCTGCTGCACGGGGTCTTCGTCCACAAAGTGGCTCTCCTGCTCGGCTTCGGACGACGCCGCGACGCCGT
GGCCCATGAGCATCTTGTCGAGCATCTGCAGCTCGTGCTGCTTGTAGAGCGAGTTCCAGTTGCAGGACGCCGAGAGCAGGCCGTCAGCGAACACAGGCAC
TGCAGACGGTGGCGCAAGCCATGCGGTCGTACCAATCTCTCCAGGGAAAACAGAGGCAACCATTGCTGCATGCAGTCCGCCCATGCTGCTCCCGGCGATC
ACGATGTGCGAGTACCCGTGGTGCTTCTGGAAGTACGCCAGTAGCGACTTGGCTTCTTCGATCGTGGCCTGGCCGAGCACGGGTAGGTCGCTCACGCGTC
TTAGTTTGGAGCCTTTCTGGTCGCTAGGCTTGCGACGACCGTAGAATGGACCTTCCAAGATCTACAGGGTGCACCCAACACGGCTATCAGACACTCCTGT
CCTAGCATATAGATACGCAAACCATAGAATTATAGAACTGTCAGCGTATAAACCACGCACCAGTGTGGCGACGCCCTTGCGCGCCAGCGGAATGCCGATG
GACGTCCGTCGATGAACAAATCCATGCTCGCCCGTTCCGGGCAGTAGCA