Description :
From Genome Similarity Track
Location :
Scaffold_1:185206- 187478
Sequence
2272 bases(100 bases per row)
TCCGAGTCGCTTGAAGCGACGTCGGCCTGAACAATGTTCAGACCCGACTTGCGGCGGCTGACGTGACGCGGCACTTCGTTACCCACGTCGTGATGTACCG
CTGACGACATCAGAGGCACTCGAGACCTCGTGTGGCACTGTGTTACTCACACAGGAAGCATGACCGATGCCTTCCTCTTCAGTTTTAGTCTGGGCGACTA
CGTGTGGTACTATGTTACCCACACAGGAAGCATGATCAGTGCCTTCCTCTTCAGTTATAGTTTGGGCGACTGCGTGTAATACTGTGCTATCCACACAGGA
AGCGGATTTTAGCGCATTCCTCTTCAGTTAAGGTCTGGGCGACCGTGTGGTCCTAAGTTACCCACCTGGCTAGCGCTTAGAGACATAACCCCTGTCGAAG
CCCGCTTGGACGCTGCTGGTGTAGCAGGTCCACACGCCGGGCCCATGCCCGTGGACATATGCCGCAGCGGAGCATGGTCTTGCTGTCACAGATCTGTCAG
CGCGTTGACAGCTCGGTGACGGTTCTGCGTCCTGACGGTCTGTATCAGACGCCTAAGTCATGACAGAGGTGAGAACATGACTCAACCAATGCTCCGCCAT
AGACCTGGACTGGCGGACCCTTCTCAGCCTTGCAACACCAAAGTCCCGGGCTGTGCCTTATGCTCAGCACAGCCATGTTATTCATGGCGAGAACTGCGAG
CGACACCGCGGTGCGCGAGTTCATCGAACCCAAACATTCAGGTCCGTTGAGGACCATTTGTACTTCCTTCACTGTTGTCCACCAAAGGACCAGCCCATGA
CCACCACTCTAACATAGAGTGCAGTCGGGTGTCACTATGCCAAGCGACGTTCCGGCGGCGTATCAACGCCCCAGAACTCATCAAACGTTCAAGGGGTACC
GTACACCGAGTGTACTACCAGCAGCCCATCACTGCCCTTCACCGGTTTGAGAGAACCACTTCTCTCTGGGCTAAGTCCCGTGGTATGCACAACCTGCACA
CCCATCACGAAGACTTAGCGCTCTTCAGTAGGGCATACCGCCTCAACTGGTGGCCGGGGAGTCTTCGTCCACCTGGCCGTGGCCTGCGCCACCGGACCTG
GGGTCCACGGGCTGTCTTTTCCCGAGGACTGGCAAGGGACACACTCGCTGGTAGTGTCCATGTCCGCCGCATCCGTAGCAGTGGACCAAGCTCTCGGCTA
AGCTTAAGTCCATGGGTTCTGGCTCGCTGTACGCGCCGGTATCAACGGGCTGCGTGACAGCAGGAGCAACAGCGCCATTGCTGCGATGTTCCTCTTCCCG
AGGAGTACCAGCCTGCTTGTGGCTGTACTCTTCGTGGAGGGCGATTCGAATCGCCTCCTCCATAGTTGTCGCTTGCACCCGGAATAGCTAGGTGCGAGCA
GGACCGACCTTCAGGCCGTCCATGAAGACTGTTGTCTTGATGTCTTCAGGCAGCGGATTCCCTGCCAGAGATGCCGCCAACGTGCGCATCTCTTGCACGT
ACTCCTGCAGCTCACGTTTACCTTGCTTACACGCGAGAAAGCGTGAGCGCTGGCGGAACTCGTTGTTCGCCGGTAGGAACGCGGCTCGAAGCTGCTCACA
CAGCTGAGCCCAGGATGCAAAGCATCCAGGAGATGTTGTCTCCCTGGTGTATGCCCAGTGCTTGGCACGTCCACCAAGGCTGGACAGGGCAAACGCCACC
CGAAGTGGCCCGTCCGAGATGAGACTCGTCTTCATGGCGATCTCCACCCCACGGACCCGGAAGTGAAGGTTCTCTCCTTCCTCCCCCTCAAACGCGGGGA
CCTTCAGCCATACCGGCTTAGGCCTGGTTGCCTGGGGAGCGGCCATCGAGGCCTCCAAGCTCCCGCGGATGTGAGCGATGAGACCACGCTCGTAAGTCTC
AAACGCGGTCACGCGTTCTTGTTGCTCGGCAGGCGTCGCCGCCACCAAGCTGCGAAGGACATCTTGTCCAAAGATGCCTCCCAGCTTTCAAACAGACTCG
TACTGTGAGTCGTTCAAGCGAGGAAACTCGCTTCGGTCCATCATTGCTCAAACGTTGAGCGCACAGAGGATTCAGGTAGTTCAATCTACCCGCGATGGTG
TTGGATTGATTACGAGTGCTACCAAGTGTGACGGGCCACACAGAACCTTGCACAGAGGAAGTGCTTAAGGGTATTTACTACCCGAGTGAACGTAAGTCCA
CGCGTTCCCGGCCTCAGTGGGAACGGTTTGCTACTTAGAGGAGTAGATGTAAGACTGATGTATTTATAAGTG