Description :
From Genome Similarity Track
Location :
Scaffold_3:185205- 188244
Transcript NameFunction/comments
Phyci_61153Hypothetical protein
Phyci_208274Hypothetical protein

Sequence
3039 bases(100 bases per row)
tagtgataatagcactacttatgtacgcatacttcaactgacggaagatcttcgaaagagcgcaaggatgagtggttctccggcctcccccctcctgcgc
acttcagtcagaaactccattcttcgacttccagcctcatacgaacgtatcatgaagtgcgcgaagaccaattgtcactggagtgccatatcggagactg
ctccgtgctgtgtatgtggccgtcaggtgcatcacctgtgtagtaatgagctatgtactaaaggcgagctttctcaaaagtaacgttgctgtctggagtt
gttttcttgccgcggtgattgtactgagcaagtccacgtgcagattctgcagccgcgcgtgtgttccgaaggtcttcgacgcggatgacagcaacctcta
ggagtccactccgagcagtacctctggaatgtcgtgctcaaacagtgccaccgtgatcgatctgaggaaaacagagctcgaggagacccctgctgtagta
aatagcgttccggatcacatcactcacacacccctgcgaactcgacagacccgatttggactttggttcactagcttggaaagccagtcacgtacaagaa
gaagcagttcacgcatatttcacagcgtgtttggagaccaaaacctggcaaaaagcactttgtcgcgcttgccacgcctcaaacaccaagacgcatttgg
tgtctgcccacaagacgcatgagatggcaattctggggcttcagcgtcatcaagttcgcgctgaccgcttcatggtgaccacgccgacggagacaaaacg
cccagctgacgacgagctatcaaccaagcgccaaaagacttggtggaaggtgtcggtcagccaagaacaaatcacaggtcagatcgcgcggtggctgatt
cgggatggtgagtgttccggtttacttttacggacaatgttttactgttgttctcatttgtattattttatttgaccacaacttcgtgacaacagatgcc
tttcacgactttctcgtaggtgTTACTGGTGATCTTAACGTCACCATTCCATCCCGTAAGACATACAACGACTTTATGGATAATCACTACGACACTTTCT
AGAAGGATACATCGAATTTATTCGCCTAAGAGTTCCAAGAGTTGGACGAGACTCCATTTATGCCTGTGGAGCACGACCTGTGGACAAACAGTTCAAAAAA
CAGTATTGTGGGTGTATCGGGTAGCTAAATTAATCGACATTGGCGTCCTGTGCGTCTCGCCCTGCTCGCAGAAGTGAAAAATGATGGCCATGATTCCGAG
GGTGTTGCAGAGGTGATGGATAAGCTGCTCAAGGCTCGGTACGGCATGGACATCAAGAAAATGGTTTGCTTCACAATCTCAGATACAGCACCAGCAGCTC
GAAAGGTTTCTAGACAATTTGATACGATTTTGCAAACGGTTTGCGCGATGCATACTCTCAATCTCTGTATTGGTTACGGAATCAGCCTCAAAAAGCATGT
ACGCAATGAATACGTGAAGGATCCGAAGACAAACGTATTCGTGAAGAAGCGCGTTGTAGTGATGGAAGGCGGTGCATTTCCCGAGGGCGGTGCACTCATT
CGAAAGCTTCGTGCTCTCAACAATTTCTTCGCGTCGAGTAAATCACCTGAGCGTGTTGCCCACCTCAAAGAAGTCCAAGGTTTCCACTAACTACCGCAGT
TGGCAGCGCTAATTGATATTGATGCCCGGATGGCATCTACAGTCAAATTATTTCAACGTTTGATCATTAATTACCCAGCGTTCCAAGCATTCGTTCAAAA
TGCGAACTTGCCTAAGAAGGACAAACGCGTTTTAAACTGTATTACGGGCGCTGAGTGGGAACCTGCAGTACAGATGGAGGCAATCATGGCAGAGAGTATG
TGAACTAGCTCTTGTCGAGTCCCAGTCGGCAACCATGTTATTGTCTACTATGTACGTGTTACTTCGAGTGGCGtcggctcgaatgaattcgtacaagttt
gcaacctactgcctgcatggacctcgcgatACCGACACTAACGAGAGGAACTTCTCTTGAGTTGAGCTGAAGCTGACTGATCTCTCGGACTTGGCGCACC
GGTGCATTAAACGCACTCTGCATCAAATTGCAGAGAGGTTCCCCAAGCCATCAGTACCCGCAGGTATGGCGCTACTGCTTGACCCACGAACGAAATCGTC
AGCCAAAACTTTTCTACGAGCTCCGGACACGGCGGAGGCTGTGACTGACATTATTTTGGAGGAAACAAAGAGTCTGATGCGCATCGAACACCGTGGGTTT
TACAAGGGATTACATGCAAACAACGGGCAAGGAGTTGGCGAAGCGGCTTCCAGCACCAGGTCACCACAAACAGAGGGCAGTGGCAGTTCTGATAACGAAG
CAGACTTGATTTACGGCGAAGCCGTTTCCCAACCAgccgcggagaaaacggcggatgcgacactaaatgctcaagccgacgcgcttgtggaggagtggct
gaacttccgaattgagtggtctgacgaagcgagaaagcaatatccagtcaaagaggagtatgagaaggtgttacccaagctgagcatgcgcgacagaaaa
cgcaatgtttacgtttggaatgttgagcagcgttgtgggcacattgacgcatgtcgttggttcgcggaggtcggcgaaaaaaactttccttctattgcga
aacttgcacgcgtctggctgggacgtgggtgctcgacggcgtttcaagaacgcatgttctcaaccggttttttcgtgatgagtcctctaacgatgagaac
cgacaacgagcgtgcgcagcggcagctcatacttcgccacaacgggcaggagataaggcgtatggaggcaagtaagcgccagatatggtagctcaactca
gtgatattagtagtcatattagtaccgtcgatgtcccgctactaatatatatagcattctactattacccgaaattggatagtagtagtagtataactac
tatccgaaattcccactaataccgaaccctgGCTGAAAG