Description :
From Genome Similarity Track
Location :
Scaffold_421:1852- 6963
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_421-snap-gene-0.6H.sapiens BTAF1, BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa

Sequence
5111 bases(100 bases per row)
AGACGGTAGACATTGCGAAAGTGGTGGCGGAAGGCGCGCCATTGCTGCGAAGTGGGGGCGAAGTGAGTGACTTGTGAGCGTACATCACTGATATACATGT
ACGTACTTAGTATACGAATGGACACTTGACATTGTGCTGTGTACGTGTGGTAGGAGTACCAGTACGAGACGAACCTGAGTCCAGAGCAGCGCCAAACTCA
GGCGATCAGGCAGCGAAGGCTGCTTTTGAGGCGCATCAGCGGCTCGACTGATGTGATTTGGACCACGCGCGAGGACTCTTTCGCTCAGCAGATGCTGCCC
AAACTCAACGCGGATCGTACGGCTGTATATCCTGATAGGTTGCTTGTGAGAAGTGGTTGTGAAGAGAGCTAACGAACCCTGTGGTGTATCCAGATGTGAA
GGACATTGCAGACGATATTGAGCAAGGCGAGGCGGACGCAGCCACCGTCGGACAGTTCACTGAGGCAGAGCGACAAGCAGCCAAGCGGAAGCGCGCAGGC
GATCTGCTCAATGTGCCACCCGTACGGCGGCGTCTCGCAGAAAACAGACAGACTGATGGTGTCACGAAAAAGCTCAAGGCAGAAGAGAAGTCTGGTTCGG
ACGCAGACGTTGTCCGTGTCGACGAGCGTGAGGATGACTCTCAGCTGCAGATTACAGCGAGCCTCGTCGCCGATCTCTTCGAAAGCGTCTTTGACTCGAA
ATGGGAAGTCCGCCACGGTGCTCTGCTAGCCCTGAGGCAGATTTTCCTGTCGTCGCAGCTCATCGAGTCGCTCGCAGTAGCCAAGTGTAGCACTTCTCCA
GGATCATCTTCAACGACAGAGAAATGGCTCGAAGAGTGTCTTGTGCGCTGCATCTGCGTGCTGGCGCTGGACCAGTTCGTCGACTACTCGGCCGATGGGT
CCGTCTCGCCCGTGCGCGAAGTGTGCGCGCAGGTCTTTGGCGTCTTATTGGGCAATCTCCCGCGCGACGAGCAGGGCTTGCTGGTGGAATATCTCGAGAT
CCTGCGCACGCTCCTCAAAGGCGCCACGTGGCACGCGTGTCACGGTGGACTCCTGGGGCTCAAGTACCTCATACTCGCCCATAAAGTTCAGGCCCAGACC
CTCGTCCCGCTCTTCTACGCGGACGTCCTGAGCGCATTTGAGCAGCGCCAGGCTGAGGAAGAAGTGATGGTGCTCGCGGCTGAGATGTTTGAGAATTTCA
CTCTTTATCTGAAAAAAACGCCGCCAAATCAGCTCCACAAGACCGCGAAGCTGCTCTGGAAGGCGCTGGCCGAGCACGCCACATCAGGTCTCGTTCCAGC
GTGTGTTGTTCGGGCGTTGAGCGCCTGGTACAACCATTCATCGCTGCGTGTGATGCTCGACAAGGACAAAGAGCTGGCGAAGCTTGTAAGATCGAGTCTC
CATCACGTGGTGCCGCTGCTGCACCAGCCCATTCGAGCAGTGCGTCTTTCAGCGGTTGTGTGTGTTGCAGCGATGTTCCAAAGCGACGACGAGGGCTTGA
AACTGACAGACCCTGCCTTTGAGCGCTACTTGCTGCCGCATCTACTGCTACAGCTGCTGAAAGAGCAGGATGCGGACGTACGAGCAAACCTCCTTGATGC
CTGGAAGCGAGCTGTGCTGTCGTGCAGTGAACGAAGAGCATTGGTCGCAGCCATTTCGACACAGTTGGCTACGTGGATCGATCTGCTCTGGTCCACCACA
GGCATCAATCTCCTGGACGTGGAATTCCAGAATCGTCCGTCTGCGGATAGTGATGCCAAGATGGTGGCCACTGATACTGAAGTGGACTCAGCGCCGCGCG
TGGCGTTCGCTGATGCAATTGGGTATCTGGGAGCCCACGTGCCGACCGGCTCGTCTACAAGTGAGGAATTCGTCCAGAAGCTCAGCGGTAGCCTTCGGTC
GGCATCTGGAGAGCGCCAGTGTGGTGCACTGCTGACGATTTCCCGATGGGCGTTCTACGAGAAGAAACAGCTGAAAGAAACCAGTGGCGAGGTCGCCAAT
CGACTGCTGATACTGCAGAACGCGCTTGGATCTGTGTTCGAGTCACTCGCTCAACACGACTGGATTGTCCAAGTGCAACCAGGAGACTCGTCGGCATCTG
CGACTGGGGTGTTTTACTCGGAGCAGCGTGGGTTTCTGAAGCGAATCCGGGCGATGGAGACATGGATCATTGAGGTATTTGCTGCAAATGGCATCTCTAC
TTGTCGACCAGCAGCTACAACAACAACAGCTACACAGGCTTCAGCTGCCGATATCTCCCGTCAGATCGCGGAGAATGTCGCGTCGTTTCCCTACAACTCG
CTCGCCAGAAGCCCCGAAGCGTTTGAGCTCGCGCATTTCAAACGCCAGGACCTCTTCCTCGTGGACGAGACACTCCAGCAGAGTTTTGCGCGCTTCTACC
ACCGTGTGCAGGGCCTTGGCAGCTGCGCGTTCAGCAATCTACTGGCGATCCCGCCCAAAAAGAGTGGCTTCCTCGTGAAAGCGCTGATGGACTCGATCAA
ACAGGAGGAGGACGCAGATTTCCAACATCTGACAGCGCAGACTATGGCGGATTTCGTCGTCTCGCAGGCCAAAGTGCAGCGGAAATGCGTCGCGAAGATC
CTCTCGAACCTCTGCAACAGCGCTGTAGCGCTCGTCTTCGCACAAAATAACCAAGAGTCGGCGATGAGCAAGGATCTACCTTCGCAGAGTACCTCTGGAG
GTCAATCGTTGTCGGCAGAAGTGCTTCGGAAGGCTAAAGTCCGTGTGGAAGGTGCCGAAAACGCGCTGCGGACAATTTGCGAGGTCGCTGGTGGACGCAT
TTTCGATATTTGTCCAACTGTAAACGACATTGTCTCAAAGAGTTGGACATCAACTACTCACCAGGAGGACCTGATAGTCCAACAGAGCAGCCACTTGGTA
TGTGTGTTGGTACCAAGTGTCCACCAAGAAGCGTTTCATCAGTGCCTAGACTGGCTGAAGGAACTCGCGATGCTGGTCACGCAGCCATTCGAAGTTGTCC
ACACGTGCGCGACAGTCGCACATGCGATCGCGTGTATCTGTCGTCACGCGAAGCACCACCAGGAGAGCTCCATGCTTCTCGTGTACCAGCGCGTCTTCGC
TGTTTTCACACATGGCTCCAGCTTATCGACAGAAGGACACGAAGCGCTCATGGGTGCCACGCTAGTACTTCATCATCTCGTGAAGGCGCTCTCCGTGGAA
CTCACGCCCTACATCCCGAGCCTCGTGCACTTCTCCATGAAGACCATGAGCTCTCAGAACGCTGAGGTTCGGTCGCTGGCGGCCCGAGCGTTCGCTGATC
TCGTGCCACTCGTCCCCTTGCAGATGGATCTCCAGGTTGCTACCTCCAGTGGCGATGGCATGAATGGCGGTGCTCTGAGCGACATTGTCGGCCAGAACCA
AGTCTCGCGGGAATTTCTGGAGAATTTGTTGGAAGGAAAAGCGGTGAAGCACGTGGAGGTTGTCGGTTTTCTCGCTGATGACGTGGCGCTGCGCTCGTAC
CAGCAGTATGGGGTTGATTGGCTGTCGTTCTTGGTCGAGAACAACTTGCATGGCATCCTCGCGGACGACATGGGCCTCGGAAAGACACTGGTAAGCAACG
CTCACGCCTATTTTATCAATGTTATATTGTTTGTTATATTAACTCACTCTCTGTTATTTATCTCCAGCAAACGCTCGCTGCCATCGCTGTTTCACTGCGT
CGTGACCCGAAGTGTGGAGATAACCCAGTGTGTCTGGTCGTGTGTCCACCAGTGGTGACGCATCACTGGATCACCGAGGCTCAGAAATGTCTTCCTGGGG
TGTTCCAGACCGTCGTTGACTACTCGGGATCGTCAGCAGACCGCAAGACTCTTCACAAAGAGTTGCTAAAGCCGTCAATGCGTTGTCCAACGCTCATCGT
GACGACCTACGCCGTACTCCGGAGCGATATTGAGCTGCTCAAGCGCACAAAGTACGACTTTGTGGTGCTGGACGAGGCTCATCTGATCCGAAACCCAACG
ACAGCGCTCTTCAGCGCGGTCCAACAGCTCGTCGCAAACCACAGAGTGGCTCTAAGCGGTACGCCGCTGCAGAACAACGTGGCCGATCTCTGGTCGCTCT
TTGAGTTCCTCATGCCCGGGTACCTGGGCGCCTTCGTGACATTCCGCAGAGAGTACGTGCTGCCGATCTCCAAGTCGCGCGAGCGCAATGCGACCCCAAA
GCAGAAAGAAGTGGCGGCGCTGGCGATCACGCGACTACACCAGCGCGTGCTGCCGTTCGTCCTGCGGCGAACCAAGAGTCAGGTGCTGACGGAGCTGCCG
CCCAAGATCATCTCCAATGTACTCACGATTATGACAGCGATCCAGAAGAAGCTCTACGCGCTGGCGCTTGGTGGCTCCGACGGTGTTATGTCTAGTGGCC
AAGAAGATAAGCAGAGTGTGCTCACGAACCTGCATCTGCTGCGCAAGATCTGCGTGCATCCGGGTCTAGTGGTGAACGAGCGCGTCAGTCAGCAGCTTAA
TGCCAAGGATCGAAAGGTGGCGTTAAATTGGCGCAGCTCGGGGAAATTGGTCGCACTCCACGACCTCCTGGTCGAGTCCTGTAACATTGGTGGTCAATCT
GGCGGACCATCGAATGCTGAAGACGACAATCTCAGTGTCTCATCTCAGCACCGCTGCCTGATATTTGGCCATCTAAAGGAGACACTGGACGTGGTTGAGC
AGATGTTTAAACAAGCGCTGCGAGACGTGACGTACCGGCGCCTGGACGGCCGCACTCCGCCACAAAGACGCGTGGAGATCGTGCGGCAGTTCAATGACGA
CCCGTCCATTGACGTGTTGTTGCTCACGACGGCGGTCGGCGGCCTGGGACTCACGCTCACGGGCGCCGACACAGTCATTTTCTTGGAGCACTCGTGGAAT
CCGTTCGTGGACCTGCAGGCCATGGACCGCGCGCATCGCATCGGCCAGCGACGCACCGTGCGTGTCTTCCGCCTCATCGTACAGGAGTCGCTCGAGGAGC
ACATCATGGACCTGCAGGCCTTCAAGGAACGCGTGGCGACGACGGTCGTAGCCACCAACGACGCGCAGACGGGCATGAATGCGAACACGAAGGAGGTGCT
GAGTCTGCTGC