Description :
From Genome Similarity Track
Location :
Scaffold_385:1852- 4941
Sequence
3089 bases(100 bases per row)
TCTTAGGTGTTGGGATTTGGTGGAGCTATCCATGTACATGATACATATATATACTACTTTCAATATCTTTGCCCTTCCCCTTATATACAAGTTGATTTGA
TTAGGGCTGAGGGAAATGGGTGCGCTGGAAACCCCTCGTATTGAAGGGGTTAAATACCTCATTGCATGCTCCACTCGGAGCAGTTTGAACTAGTGAGCTC
GGCAGTGCAGGCTTTTCCTCACGATTTTGGGTTTGAAAACATTTGCGACCAAGGGTCTATAACTACATACGGAGAAAGATCACCAGTCGGAATGATGGAG
CTTCAGACGTTGATGACGGTTGTTTCGAGGCCGCCTTCGACCACAATTCATCGCCTAACGGGAGCAACCAACCATGCCAGCGCAGCGTCCTGTAGACAGG
AGTGCTAGGTTTGACATATCTTCGTTGTTGTCCCCCAGGACACCTGCTTCAATACAACCAGGTCATTTCGAGTCACCTACACGCGACAATTATCCGCGCC
AAACAACTCATTATTCAACGGTAGATGGACGCCTGCCGCTTGCATCGCCTGCCTTAGGTATTCACGACTTGCTACGGTCGATAAGTTAACATCGACTGCT
CTTTCGTCCTCATCAAGATTATTGTATTCATGTTTGTTACAATTTGGACCTCACACTTCCTAGGCTCGTGAGATATAGTTCTGACGACGATCGATCATGT
CCGTTGGTGTTGCCAAACGGTATCATCAGCATTGAGCCACAAAGTCAGCGCTGATGTTTGCGATGGTGGTGTAAATGTGATGGATATTGTTGCCCACTTT
AACTATGCTAGCAATTGTCAACGCTTTTATAAGATGTTGGTGCACTTGTAGTTACAGTGCATTGTCTCGCTTTCCGCATGCTGAGAGCGAGTCGATGCAG
TTGTGCATGTGTGGCGTGGCGCACTGAGTTAGGCTCTCGTGGcaaccaacagcagcgtcgaaaaaaaaacagcGCTCACCGAAGGAAGCTTGCTGAGTCT
GGAGCAGAATGACCAAATGGTGAATGACGACAAGAGTAGATGAACCAGTCAAGAAGCAAGTGCACACGACAGATGCGATGAGTGAAGGAATCCTCGCTta
cttgctgctcgtggcctCATGAGTAAGAGCAGATGTGCGGAGCCGCATGAGGAAAGACTGCATACCGCCTAATAGTTTGCGTACCGTTAGACCGCTCCCA
CACTAGACTTATCCGGCAGGCTTCCGTGGCGATCGAGACGGCTATCTGTGTCCCAAGCTTCCTATccacctggagctggaggaagtACTAGGCTGTAGAA
GCCTGATTTTTGACGTCAAATGCCGAAACAGACCACCCGCGGTCATCGACGTGGTAACCACAGCCGtctcagcagcagtcgatTTTGTTAATTCGTTATA
GGAGCTCGCCCGCTCGATTCTCATAAGCTGCTCGTTGTCCGTCAACATTCCTTCTACGTCCGCTAAGTTCTATATTGCTCGTGACATTTGTTAGAAGCAA
TACGGTGCTCGAACGCGTGCAAACGAATAATGGGCCGCCGCCTGTACCCATCGTCAACTCCAGTCGACGCGCATTGCGCACCGACAGGTCTTGCAGCCCA
GGCTGAGCGGTCGTTTTCTCCTCGTGCTTGCCTTCGTTGTTGTGTCGGATCTGTAGCTACTGCAGCTGGCACGACCGCTTTCTGATAAAAGTCGATACAT
TGTGTTTCAGTTGACGATAAACGTCTCTCCTGATGTCTGTCTATCGTCTTCAATGCTTTCGTGTCCTGTTATTCTCTTTCACTGTAGAAGTCGTTACAAT
ATCTTTAAATCCGCTTCAGTTCACCCAATAAACATCGCAGTGTCAGGTGTGTATTGGTGCTTGGTACATATTTAGTCGACGGTCGATTAAACCTACACTG
AGAGCCCTAACCAGTTCAAACGTTAGCCGGTTCCGCTTTCGGGGAGTGTGCTCACCAATTCCTCTCATTACAGATTCATCAAAGAACGCGTACAAGTCAT
GGGGAAGAAGCGAATTTATACGATGATCGAGAGAGTGAGAATCCTCAAGGAGTGGCAGAAAAATCTTCAATGGAAGCATtcgaaggcggcgatggGACTG
GGCGTCAAAAAGGGGACACTACTTGGTAGGAGAAAACAACTCTCCGATGAAAAGCTTTCATATATCAAAGAACCAACATGTGTGGACGGGAGATTTAGAA
AGTCGAGTTCAGGGCCACCGAGAAAGGTTCAACCATACGAAGATCGCATGCTTCAATTCTACGAAACCTCTGGGTGGACGGTAACAAGGCAACGCAGACT
GAGATGCTATAGTACTGCAACCAAATGTGTGAGTTTGCGGCGCGGAACGACAATTCTAGTCGAGTTGGGTGTTGCGTTTCATGCGTCATTATTGGCCAAT
TGTTGTTCCGGagatcgccgtcgtcgcacctggagctgccaaggacggtggcgctgccgaACAGGCTAGCACAATGATAGATGTCGACTCCGACGTCGTT
GGGTAACAAGTGGTAGACTCTGAACCCTCCGAGGCAAGCGTCATGGAGATAGATGACGTCGAGCATTCGGATGTCGCGCCCGAAGACCTCAGTGCACCGT
GCACGAGACCCCCTGAAACCAAATCACCACGACCGAGGACCctgacgaagcagcaggcgagcTCGGGTCCTCTGAGGACTATGAGTGCCCCAGAGGATAT
TGAACATGAAGGCGCCTAGATAGAGGTCTCTCTATACGCATGCGGGTGGGGATCCCACAGCGCCGGGGTGAGGCAGCTACCTTCCATTCGTGAGCGGGGA
GACGGTCGTGATCCAGGCTGGTGTACAACCGGACTTCACCTTTTTAGTAGATTGGCTGTTCCAAAGGCCGATCTACAGCTCTTCCTCGGTCCTTCGACAa
ttccagctcttcaagtTCTAAAACAAATACAAAACAGGCGCGGAATGGTCATGGACGCCGATAATATTAAACGGATCCTTTCTAGCCCGACAATAACCCG
GTACCAGCGGCGCGTTACTGCCCTTCAAGCAAAGCAGGAACACCTGGGTGAAAAGGGCGTAGTTATTGAGGTAGAAGACATTGGCACTA