Description :
From Genome Similarity Track
Location :
Scaffold_316:18518- 22009
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_316-snap-gene-0.14WW domain-bindinG-protein 4
Pytul_var.sporangiiferummaker-pug3_contig_316-fgenesh-gene-0.8Succinate semialdehyde dehydrogenase, mitochondrial

Sequence
3491 bases(100 bases per row)
CGCCACGCCGCGACGCAGATCCAGCGCATGGTTCGCGGTTTCCGCGTCCGCTGTGCGGTTCGCGAAGGCGGCAATTGCTGGATCGAGCTCTGGACTTCGG
GGGATGGCATCAATAGCATTGGTGGTGGTGGTGCACAGCCTGCAAAATACTATTACAATACGCTAACAAGCGAGACGCGGTGGCAGCGTCCACTGGCGAT
GGACATTTTTCACGACACCTTTGTGGAGCCTATGCTACCTGCAAGTACAGAAGAAGCAGCAACTTCAACAGCAGGTGGACAAGTGTCCACCAGTAGACCA
TTGCCGTCAACATCAGCAACAACAGCAACAATCCGTAGACAAGGCGCGTGGTACGAAGCGTTTGATGACAGACTTCAGGTCACGTACTACTTCCACAGCG
GCACCAAGGAGTATCAGTGGGGGCATCCTCCTGAAGACAACACTCTCGCCAATGCGTTTGAGAATCAGTTCACGAGACGACGACGGCAAGAGTGGATTGG
CGAGTACCGGGACAACCTCGAGGAGCTGCTCGCAATGACGATTGTGCGGCCTGGCACGGCAATCGGGCCTTGGCAAGTGCGCGTCGACCCGGTCAGCGAG
CACTTCGTGTACTNNNNNNNNNNNNNNNNNNNNNNNNNAGAGACGCAGCAAGTCAAGGCATCGCTCTCGCCACGAAGTGTCCACATGTCGATCAGTAATG
CCCGCAGCAGTAGGACGTCGAGACGTTCGCCTGAGAGTATCCGCACTGGCGAACATGGTAGCAATGACAGTGAACGCAATGCATCGTCGGCGCGGTCAGT
GCAGTGGCAGTATCGCTACGGCTACGAGTACGATGTGGTCTCGGGCCATCTCGTCGCGAGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGACCCAGCGAGCGGCCTTACGTACTACTTCAATGCGCTCACGAACGAGTACCGCTGGGAACGGCCCCAAGACGTTGACGCGACCTTTGACGAGTATCTG
AAGCATCCGAACGCCTCACGAGCATGGTTTAAGGCCACGCAGCAGCAACAGGGTGACACTAACAGCAACCGAGAGCCCACATCGCGGTCGCAGTCATCAC
AGCGAACGACTCGCGCGCTCGGCAAGAAGTGGGTCGAGCTCATGGACCCCGAGACGCAGCACACGTACTACTACAACGAGATCACGAGTGAGACGCGCTG
GTCGCTCTCGCCGCGGAGCGCGCGGTCCGAGGCCGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGCAGGTCAAGAGGCT
GCGGGAGGCGCCTGTGGCGTACGAGTCTCGAGACGAGCACATGGAATGGTTGGAGAGCGCGATNNNNNNNNNNGAAGAACTGGAAGCAGACGGATGCATT
CGTGCAGCAGATTCTCATCCGCGAGCAGAGCCAGTCGGTGAGTGCGCGGAAAGCGAACGGCGAACGGACGAACGAGGCGNNNNNNNNNNTTGACGCCTTC
GGCTCTGCGAGTGCGTCGTTGGAAGAAGGGGGAAGCATTGCGGAAGCTGACGTGGTGATGAAGACGTCACTAGCGAGTGGCTGGGTCTCGTATTCGGATG
AGAATGGCGCTGCGTACTTTTACAATCAGCACACGGGCGAGACAAGCTGGACGGCGCCAGTNNNNNNNNNNNNNGCGCCTGCCGTTTCAGTTGGAGACGA
AGCATCTTCTTCTTCTGAGTGGCAGCGTGCATTCGACGCGGACGGCAACACATACTACTACAATGCCGTGACAAAAGAGACCTCCTGGACAGATCCGGCA
ACGCTCTTCAACGTGTATTGATGATGATTCTGCATACATCACCCAAAGCTAACTAGTATTTCTAAAACGACACTTTCAACACCACTTACGCCAGGTCGGC
CGTGACCACGAGCTTCGTCTCCGTGTACTCGTCAAGGCCAAGTGGTGAACCTTCGCGACCGAGTCCCGACTGCTTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNACCAAACGGCGCTTGCACGTTCGAAATGAGACCCGTGTTGACGCCGATCATACCACACTCGAGCTCTTTAGCGACACGCCACGCACGCGACATATC
GCGCGTGTAGAAGTAGCCCGCGAGACCCGCTTCCGTGCTGTTCGCCTTCGCAACGACTTCTTCTTCGCTAGAGAACGAGAAAAGCGGCGCGATTGGACCG
AAGATCTCTTCCTGCGAGACGCGCATCGTGTGGTCGACGTCGGAGAGCACCGTCGCTTCGTAGAAGTTCGAACCGAGCTCGCTCTTCTTACCGCCCGTGA
GCGCCTTGGCACCCTTCGATACCGCATCGTCCACCAGATCGGACGTCTTTTGGAACGCGGCTTGGCTGATCAATGGACCCAATTGGATGCCAGGCGAACG
TGGTCGTCCCATCTTTAGATTCTTCACCTTGGCGGTCAGCTTGTCCGAGAACTCCTGGTAGATCGACGAGTGTACAAAGACGCGGTTCGTGCATACGCAT
GTTTGGCCCGTGTTGCGGAACTTGGACGCCACGAGTCCATCGACAGCAGCATCAACGTCGGCATCTTCAAACACGATGAACGGCGCGTTGCCGCCCAATT
CGAGAGACAAGCGCTTGACGTTTTCGGCCGACTGCTGCATCAAAATCTTGCCCACGCGCGTCGATCCCGTGAACGAAAGCTTGCGCACATCCTTGCTTGT
CGACAGCGTCTCACCGATCTCAGCGGCACGAGCATGTGGCGACGTCACAACATTGATTANNNNNNNNNNAAGGGATGCCGACGTCTTGCGCCAGCTTCGC
GATCGCCAACGCCGACAATGGGGTCTCGGCAGCAGGCTTCACAACGGCCGTGCAACCAGCAGCAAGGCATGGNNNNNNNNNNNNNNNNNNNNNNGAGCTT
GCGCGTGATCATCGCCAGTGGAAAGTTCCATGGCGTGATGATGCCGCACACACCGACAGGTTCCTTGACTGCGATCAGCTGCTGACCTGGTGCACCTGGC
GGCACGACAAAGCCCGCCGAGTGCATGATCTCGTGTGCGTAGTAGTCAATGAAGCCCGCGGCGTATGCGACTTCGCCCTTGGCTTCGGGCAGCGGCTTGC
CGCTCTCCGCCGACGCGATCACAGCCAAGTCATCGGCATTGTCACAAATCGCAGCGTACCACTTCTTCAGCAAGTTCGAGCGCACTAGTGGCGTCGTCTT
CCTCCACGAGCGTTGCGCTTCCAACGCAGCGTGGATCGCATCTTGAGTCTCCTCCTTGCCCATATCCGCTACACGCGCAATCTCCTCATCCGTCGCAGGA
TCTAACACCCATGCAGCGATAAACCATCCAAATGAGCCTCACAATAAACCACATGACTAGTATCAAATATTCTATCTCCCATGTACATACCGGTGACGGA
GAAGTGCGCCTTGGAGTGCGCGTCGATCCATTTGCCGTTGATAAAGCCCTGCGTGCAGATCAGATCGCGGTTCTGTACCTCCGAGTGGAAG