Description :
From Genome Similarity Track
Location :
contig_21:185154- 186236
Transcript NameFunction/comments
g3857.t1hypothetical protein PHYSODRAFT_558276

Sequence
1082 bases(100 bases per row)
CAGCGCATCTCCAAGCAGGAGATCCGCGAGCACGGCGAGGAGGTTCTACGTGGCCTCATTGACCACGTGCACACGAGGATGCTGCAGGAGTTGCTGTTCC
TGGAGCAGGCCATCCCGCCACTTGAGTTCGAGCGCAGCTCCGTCGAGTCCGGCTTCGACCCGGGCGCCAGCACCGCCGGCAGCACCAGCAGCTCAGTGCG
GTCCAGCTCCTCCAGCATCTGCTCCACGAACGACGGGTTCCGCATGATGATCGACACTGACGAGCCGCGGTGCATCTTCCACACGAGCAAGAACTTCAGC
GTGGCCGAGAAACTTCTCGTCTACGTGTGTTCCTTCAGGGGGTTAAGTTGTGGCATCTGGAGCCGCAGTGTCTTGCTGAAGGACGGAGTGCAGGTGGGCT
CCATGCTGCCGTACTTCCAGAAGGCCATTGCTGCGGGCTACGGCGTGTTGGTCATGAACCCAACATGAACACGCAGCTGATGGTGACTCCGGATGGAACG
GTGGAGAAGATGCCGATTCGAGGATCCAGCAACGCCGACGATCACTGCGACCACGTGTGGCGCAACTACATTTTCCCGTCGGCGGCGCACAAGGTGCACT
TTATCGCGTATGGTTATGGAGGCGTGTTGGTGACGCAGCTGATTGCCAAGTACCGCTACGAGCTCAAGAGCCGGCTGGGCAACGTTGCCTTCATCGAGAG
CTCGCACAAGATCGACCCGTCCTGGAACTCGGGCTTCAAGCGGTTCTTCTCGCAGCACAGCATCTCCTGGTCCCGGTCCGACTTCCCACTCAACACAGAG
CTCAGTCGCGATGCTACGGCGTTTGCATCCAGTGGTGGCCCGAGCGGCACGGGACCGCGACTAGCAGTGACGATGCATTGTCGCCGTCATCTCGTTCACC
AAAGAGCCCTAGCGCCGCGCAACTGACAGGATTCGGCTGCATCTGCCTGTCTGCGGGTCCTTGTGAGGGCCCCAACGAGAGTCCTGCGTACACGACGAAG
GCTGTTCTGGACACTGTGTTCGCGTTCCTTGCGTCCCCCACACCTTACGAGTTCCAGCGTCGCGCCGCGCGCGAAGTGCGTC