Description :
From Genome Similarity Track
Location :
Scaffold_37:18515- 23216
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011711Similar to infB: Translation initiation factor IF-2 (Rhizobium loti)
Pytul_DAOMBR144PYU1_G011710Similar to Muc19: Mucin-19 (Mus musculus)

Sequence
4701 bases(100 bases per row)
ACAGCGAAATTGGGTTACAAGACCTCAAAGCGATCTGCGAGCAAGCGCGTCGCTGGAAAGGGCCGAGGGGGACACAGCGCAAAGTGTTTGTGCACGATTA
CGTGCTCACGGACCCACTAGACCCGCAGTTTGAGGAGAAGAACGTGCACATCACTGTCTACAACATGGAATTGGACGGTAAACGGGAATTGCATCGGCAC
TTTCTCAAGTCCAATGACGGCGCCATCATCGAGCTCTTTGGCGAGATTGGAACCGGAAAAGACGGCATCTGGAAGCATGACGCCCACGGTGCAATGTCGC
TCGCGCTGTTGTACAATATCGTTCACGAACAAAAGGAGTCGGCGGAAACAACTGCCGAGGAGCTCGCAAAGTTGTTTGCTGGAGTGTAGAGTTGTTATAT
CTGCAGCCAACGAATAAATAGAAGTCCGGTTTGGTTTGGACAAAAAAGACCGAGTTACGATTGGTTCCTTAATATAACCCGGTTTAGATAAGATCGGGTT
TGATATGCTTTTTTAGAGAAGTACGACCTTGCCCCAAGCTGGGCTATGATCATACCTTCGTCTTGGAGAGTGAGCAGCGCGCAAATACAGGAGGCTTCTA
ACCAATCTGTGCTAGAAACTGCCGTGTTGGCATGACCACTTGCGCATTAAGCCTGCCTCCACTCTATGGTCTCGATGATACTAGTTTACAGGGTAAAATA
TTATACAGGCCATATACAGACATGATCTGATTTTCGTTCAGACCAATTTATATAGAAATTTGTAAAAATTGCTCTCTCGTCTGCCTTCGTGCTCAGGGAT
ACGATGTATGATTTCTGGCGGGTGTTGCATACTCTGCTCAGTAAACTTTGGTCGCTGGGCCCGCCTTCGTAGGTCAGGGGACTCGCTCTCTCTTCGCTCG
CTCTGCATGCTCGGCGGCGCCGCCTTGCGGCTTGCCCCCCTGTCTGCTTTGGCTTCGCTCCCTCGGTTCCTTCACTCAAATGTACAGGGGTCAGCCAGGA
AAGGATCAGCCGGGGATGCGTAAGATTTTTTTTCCCTTAATGATCGTCATCAATACCAGCGTCGAAGTTTCGGTGCGTTTGACTGAGCTAGGGGTAAAGA
TACTTCAGTGTGCGCAGCGTAACGACATATACCTCACTTTTACTGTAGCTGCAACCGATGCACTCGACGAGAAATAAGACAATGACTGAAAGCTGCACAA
CATACCTTTCGAGAACGTCCCCACACTTTAAATCACGTTTGGGCGACGCAAGCACAAAGCAGCCGTTGTGTCGATGAAAACGGATGGCACTTCCCTCCTT
GTGCGACGGCCGATGCACTCCTTCTAGAATTCTTCGGGTATGAGCCAGTTAGAACAGTTCAATTGAGCTCTATCGTGGCAGGAGCTAGCTCACCTAACTG
CCACGTTATATATGTTCACTGGCCCAAACCGAGATGCATACCGGTATTGATCTAACCGTGGGGAATGATCTGCGTATTCTATTGCAATCGAAGATGTTTT
GCTGCAATTGCCCCAAACAAATAGAAGACATAATCGTGTCCAAACCCAATGTGTAGAGGCGATCACGGTTAATAAAGCTCAAGTACATCGCAACCAAATA
ACTCGTTTCTATCTGGTTATCAAGATACTATCGAAGACAAGAGTGGCTATCACTCCTTGCTGGTAGGACGTGGTAGTTTTCCATAATTACATGCCTTCCA
GATATGGAATGCATGACGAAGAGACCATCGATTTCTGGTGGGAAAAGTTCTATCAGTCGTCCACACACAAAGAAAACGGTTGGGCTATCTAAAATAACAC
TAGTAGCCGACTTCAGTGGTGCACGATTGGGGTAGCTGAAACTTTTACTCCACTACAGACATACTAGATTTGGTCGTCTGATTAATTTAATCGGCTTTAG
TAGTGCCAGATAATGGACCAAAAATCCCGTAGAAAATTGGAGATGGAATGCTTGAACTGAGCATATGTCCCGAGAGATGCGTACAGTCGAAGATATGTGA
CCTTTGGGAAATGGAGCCGATACGCTCTTGATCTTGGCGCTCCCAATCGCAAACGAAGGAGCGCAGCGGAAGAAGGCATGCCAACGCGGCAAGGACTCCG
CCACAGGCAGGTTTTCGCTGGTGCTTCACTTCCTTGAATTCTATAATGGCAAATTATGCGGGAACATCTGGTGCTGTAAAATGGAAACTACTCAAAGTGC
AACGAACGCTTTTGTCAGGTTATCGGGTTTCACCTATTTTGAACCGTCAAAAGTCTGTAGACCTCTCCTTCTTTCCAGACCTAAAACAGAAAAACCACTT
TGGCCAATGTGCTCGGTTTTTATAAATGGAAAGAATGGTGTGAAAGAAATTGGGTTTTGCAAGGCACTAGTGCTCAACTTACACCACTCGAGATTGTACT
GCACGGTATTCACTCTCGAACGTATACGACTAGATATGCATGTAGTCTTACTCCGGAACATAGGACAGCACTACAGAAACTTTGGTTTATCGTCACATCA
AGCATTCCAGTATCGCTATGAAGAACGAGAGTGGAAATAGTGCATGAACAACAACATCTCACTACCGAAGAAAGCACCCAGCGCGTGTGGACAGCATGTG
TGATGCAAGTGCGGGCTGTGGCACATCGGATGAGAACGCTCAAAGGAGAAAAGATCAATGCAACTTGCCTGAACCAACTGCTCAGTGTACTGGAGAGACA
AGATTTCTCGCGCCAACTGGAAGCATGGGCAACGGCGCGTCTGTATTTCGATGGAGGTGCACGCGGCAATCCAGGTCCAGGAGACAGCGGATGGGCACTC
ACCTTCCTGAATGAACGCTGCAATCAATGGGAACTCAAAGCATGCGGCTATGCGTACATGGGACCAGAAGTTACGAACAATTGGTGCGAATACAGCGCAC
TGAAAGAAGACCTCGCATACAGTGCACACTACCTAAAGCATTATGAAGTCAAGTTGGAAGTCTTCGGAGATAGCCAAATGATTGTCGCAGCCCAGAACGG
GTTTTCATCAATACGCCAGACCAAGTTGCAGACACTAGCAGTTCGGGTAAATCAAATCATCGACAACTTTGCGTAGGTCACCTGGAATCACACAAAACGA
GAACAAACAAAATGGCCGATCTTCTCGCCAACATGGCAATGAACTCCCAGAGTGCGAAGATACTCACCGACGAATCGCGGGGAAATGACCGAGTTCTTAT
GTCCCAAGTCGCAGATCTACTCGAAAATGACGTCGGTGCCACACCGTCAAAACTTAGAAACACCTCACTCTCAGCAGTGTTAATGAGACTCCGGAATTCT
TAAACTATATGTAGATCATAAGTTAAATAGAATGACCTTATCTCTCTCTCACTAGATATGCATGTAGTCAGTGCTTGAATTGGCTACACAGGTGCTCACT
TAGGAGTATATACAGTCATTTTGTTGTAAGCGCGATAGTGGTGGCTCCAACGCAATTGGGGTCCTCATCGTATTGACCAAGATCCTTAGGAAGATGTATG
CAAGATTTTTACTGCCGAATGATCATCTCACTATCCCACACACCTGGAGCTGACTATTGCCCAGACGATCTTGGTCGTAGAGGCGCATGCAGCATGCGCA
TTGACACAGTTTTATTTTTGTGTGGTCTTGGTGCAGCTTAGTAATAGAAGACCGGGTTCACTTTGGTCTTCTATTCCAGTGTGTCTGTTACATACCGAAG
GCAAAACCGGTATTTTGTACTTCATTGAGCGCAGGATAACCCTTCTAGAAACATCCTTCAACAATTAATAAACATACTCAAGATCATATTAATTTTACAT
TTTGTTATGCATACATCTATTATTTAGATCTTATCTATTAATATTTGTACCTAATCACCCTAAAGCGCGACGTGCAGCGCCATCCTACCAAACAATCCCT
CATTTCGCAGCTCCGATTGGAACAGCCAAACCGCGCTGATCTGCTGGTCGAAGCCGCTTGCTCCGCTTCCTACGCGCGTGACTGTGGTGTCTGTATCGTG
TGTGCTGAACGCCCGCCGTCCATGCAAAGCGCAGAATGAGCGGCCGCGCACATCACAGCAGCAGCAACAACAGCAATAAGGCCCAGCCGCGAGCACCGGC
AGCAGCAGCAACAAAATCCGCAAGCGCGAGGTCGGCGGACATCACGTGCTCGGTGTGCGGGCGACTGAACTTCAGCCACGAGGCGACATGCGAGTCCTGT
CGTCCAGCAGCGACGAGCGGAAGCGCAGGCACTAGCAAGTCGACAGCAGCCGCAGCGCCGGCATCGTCGTCGTCTACATCACCGAGAACGACAGCCATCT
TGAAAGCGCAGCAGATGCCGCTGCCGACGCGTACGGGGATCATCAAGGGGCTGCGCCACGGCCTCCCGATTGATTCGTATCGTAAACCGAATGCCAACAG
CAGCCAGCCGCGAGCGGCACTCGACAACTCCCAGCAAACCGCGAGACGCACGGTAGCGCGCGCCAATTCGCTGCCTGTGATCGCCCCCGATAGTAGGACG
GCAGGTTCGTTGCAGCGGTCCAGTTCGTTTGCAGAGGCTGCGAGTTCCTCACAGACAATGGGGTCGTCTCAGTCTAATGGCAGTAGCTCCCAGCAAGAGC
CACTGGCCACGGCTTTACGCGACCGAATCCAAGAAAGACAGCGCACCATCGCCAGCTCAGCAACAGCAGCAGCAACCGTGAATAGTTCCAGTACTGCAGC
C