Description :
From Genome Similarity Track
Location :
Scaffold_34:185133- 188174
Sequence
3041 bases(100 bases per row)
AGACAAAACAGTTCGCTGCTCAAGGCTGGGACGCCTTGAAAAGCAATTCGTTTTACGAAATTCTGTGAATGCACCGTGGTGTATTTCCTACAGAAGTGCC
AAACCGCCTACCAATCGATAGGGGTGTCCGGCACGAGCTTGACTTGAACCTGGCACCAAATATTGTGTGACCAGGCAGTGGCCTTTGCCGAAGGAACTGG
TCGATTACATCGACCAGTTCTTCGACAGTAGAGCCAAAGTGGAACATGTACGTGAGAGCAAATCGTTTCACTTCCGCCCGACCTTTTGTGTGCGTAAGGC
AACAGGTGGTTGGAGCGTTGTTCATGCTTACAATAAGTTGAATATGGCCACCATCCCAGCGCAGACACCGATCCCGCGGAAAGATGTCCTATTGAACTCA
ATGCCAAAGTCAACTATCTTTTCCGCGTTGGATTTGAAGGATGCTACTATCAGGTACTCATGAATGAGACCGATATAACCAAGATGGCAGTTAGCACCCG
AAGTGGTATGCTGTGGGAGTGGCTAATGATGCCGCAAGGGTTAAAAAACGCACCAGCGACATTCAACCAGGTGGTCGCTCATGTAATGTGTCCACACCGT
GCCTACGCGCCCCTTACTACTTTTATGTTGTATTCGTTCATAGTAGGGCCGAGGACGGACTGAGTGAGATAGAGAATCGTCCAAACTTCATTTGGACGTT
ATGTTGCAGACTCTGGGCGACGCCCAATTGTACGTTAACTTGCACAATTGCGTCATAGGGGTCCCCGAAATACATGTACTGGGCTGCATCGTGGGAAAAC
ACGGTGTTAGAGCAGACTCAGAAAAGGTTAAAGCTATTAAGGAATGGCAAGTCCCACGACATGTTAAGGCTCTGCGTCAATTCCTTGGGCTTGTCAATTA
CTTGCACATATATATCAAGAATTATGCAAAGCGAACCAAACCAATGTCTGACCTCCTGAAAAAGGACGCAGAGTGTACTTGGTATGAGGCTCAAGTAGAT
GCTTTCACTTCAGTGAAGCAATCACTTGTAGAGGCTCTGGACTTGGCTTTGACAGACACAGATAATCCCTTTAGTTATTTATGCGATGCGAATAATTTCG
CTATCAGCGGTGCAATTATGCAAAAGGATGACGACGGTACTGACCGTGTCATCTCGTATCCGTCCCTACTTTTATAGGCCGCGGAGCTGATTTACCCCGT
GCACGACAAGGAGCTAATTTTCATAAAGTAGGCTCTTGCTAAGTTTCGAGTGCACCTATGGGGCACCGAACCTTTTGTAGTTTACACGGATCACGCATCA
TTGCGGACCGCGATAAACTCGCCGCACCTATCACCTAGGATGGCGAGGTGGCTTACATTCTTCGCAGAATTTAATTTTCGATTTCAATACAAACCGGGGA
GGTCGAATGTATTGGCTGATGCGTTATCGCGCAGACCAGACTTCGAGGAACGACACCTTGAAGACATGTCTCGTTCTAGAGCACGAATTAAGTTGTCAAC
ACTAGCAGCTCTATGGGTTGACCATGTGCAAAACAATCTGGTCTCTGACATAAAAGAGAGCTACATGCAGGCCGAACATTGTTGTTTGCTTATAGATCAC
TTTGGTGGACGGAAAGTCACCCTTCCGTCGCACCTCAAGGCGAAGCTTTATTGCTTTAGTTGTAGTGATGGCCTGTTATGTCATCAACTATCACCTTGTG
ATCCATTGAGAATCTATGTCCCCCATGAAGCAGATTTCAAACCGAAAATTCTCTACGAGATCTATGATGCACCATCAAATGGTCATCTGGGCCGTGAGAA
GACATTCTTACGAGTGTCAGATGAATTTTAGTGGCCACACCTATATAGGTGGGTAGCCAATTATGTTGATCAAGCGAAGAGTGTCCGCGCGTAAAGCCTA
CACCTTATATTAGTGCGTCACTGAAGCCACTACCGATACCAACTGATTGTTGGAAGTCGGTCAGTTTGGATTTTATGTTTGGATTGCCGCCTGACCATAA
AGTCAGGACTGGTCTCGTCGTCTTTGTTGCCAGACTGAGCAAGATGGTGCATTTAGCACCGTGTAGCACCAAGATCTCAGGCAAGGAGGCAGATTTCTTG
TTCCTGGATCACGTGTATCGGCTACACGGGATGCCCGAGTCCATAGTCTCGGACCGGGATCCACGTTTTACGCCAGGGGGTTTGGTGCCATGTGTTTAAG
CTGCTTGGTAGCAAGCTCCACATGTCTACCGCCGATTATCCCCAAACCGATGGCCATACCGAAAGGGCCAATCGTGTTGTGGCGGATACATAGCGCACAA
TAGAAACTCCAGAGGAATGGAGCAAACATTTGTCATTCGTGGAGTTTGCTATTAACAACAGTGTTCACGCCAGTACGGGTGAAAAACCATTTTATGTTAG
CGGACTGTGCTATCCTCGGACGCCAGTCTCGTTTGTGCGCAGCCCGAGTCTTAGCGGGGGAGGGCCCCTCACTACGCTCAGAGCGAATACGGAAAAGCGT
AATGGTTTCGCCAATGTTATGGCAGAAACTTGCTCTAGTGACCCTGCCAGTGCCGCAGTGGTCACGACACAAGAGAGTGTCAAGTCAGAGTCACGACACA
CGTTGTCTGTGCTCCACAGAAATGAGCATAGGTCATCATTAGCAGCAACGACCCATGACCGACCTCTTGGTGGTGTTATTGGCAACTGGATACAAATAGC
ATTAGAGAATCTCAACGCTTTGTGGATGAGCGATTAGTTATCACACGTAAGGTCCGTGACGCTATGGCAAGCGCAAAGGACAAGCAAAAACAATATGCAG
ACCGAATTGGTCGCAAAAATCATGAACACTTTAAAGTAGGAGACAAAGTACTATTAAGTACTAACACTCTACCTAAACATGCAGTATCAGTACTACCTGG
TGGTACTACCAACTTATTGCCACGATTTATCGGGCCTTTCACTGTGGTAGAGGAAGTCAAAGACCTAAAATATAGGCTCTCTCTTCCACTATACATGAAA
ATACCCCCGGTATTTTACGTGGGTCGTTTAAAGCGATATGT