Description :
From Genome Similarity Track
Location :
Scaffold_192:1851- 6689
Sequence
4838 bases(100 bases per row)
GAGGGAAAAGAAGGGGAAAATCTCCTCCTGTGGATCATAGAGGTGGAAATGGCTATGAACTCCGCTATGCTCCAGTCGGAGCAACAGCGAGTTGGGATGG
CTATCTCAAAACTAGGTGGTAGAGCCAGAGAATGGGCTCTCACGTGTGATACGTCGGTGGACGAAGCTTTCCCCACATGGGACTTGCTAAAACAGCAAAT
TTTCCGGGTGTTTGCTCCGCCTAATCAGGCATACCGGGTGCGTTTTTGTTTCCTATCTGTCCGTCAGGGAAGAAAGAACTATCGGACTATGTCCAGGAAC
TGAGAACTCTAACCGCTGCCATGCAGCTTGATCCCTTATCAGAAATGGTTTTGGTTACCATCTTCACGGAGATCCTTCGTACGGGCGTGGCTCGAACGGG
AGTATTCCGGTTACACCCCACCTCCTTTGAAGTGGCTGTGGATATCGCGTTGAACGCCGAGTTCAACTTCAAGGCAGACCGTTTTGGCACCCATGGGTTC
AACCAAAACTCGGTGAACTCCTTTAGTTCATTCAATAGGCCGGAGACCATGGACCTCAGTCTCGCCGAGACTGACGAAGAAGCAGAGCTTCAAGTTGTAG
AACAGCATAGAAACATTCGACGATGTTTCACGTACGGAAGCACAAAGCATCTGTGACCTAATTGTCCTTTACGCAGGGCACGCCAGGCTAATTCAGGCCG
AACTCCCGCCGCTAATTTGAATTCTGATACGGTTCGGGAAAACGTAGACTCCCAGTAGGCGCGGAGCGTCCTGCTGGGGAAGATTAGGTTCTGTTGAGCC
TCTAGGAGGTAGTGGCGAGCAGAATTTAGCCCCAAAGAGTCCCGTGCACTCTAACACGGGACGTCATTACAAGCCAGGCTTGTTGGTCGCAAAGACGACT
GTTAAGGGCTTTTTTTTTGAAAAACCTTGGTCGATCTTGATCGACTCCGGAGCATCCGGTAATTATGTCAGACGCTGTTTTCCTGAAAGAAATCCACGTT
TTGTTGAGGCGCTAAAAGCGCACAAGGGTGATATGATCACTGTTCGCTTGGCGACAGGAAGTCTAGTCACCGCACACAAAGTTCCTGTGAACTTGAGTGT
GAAGTTTTTCGATTTTGATAGTATCGAACGCTGTTTAGTCCTTGATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGAG
CCATGAGCCATGGATCGACTGGAGGTCGAAACATTAGGCGCCACACGCACTTCCCCTAGCTGAGCTTTGGAGAGTCATGAATCCACTCCTGCTAGGAATC
AGAAGCGTTATTGGCGCGAGCCACTGGCTGACAAGGTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAATAC
AGAGCAAAGCTCAATATGTGATAGTGAAGCGGCACGTACTCCGCTACGTGATAGTCGTTGTGAGAGCAACGTACTGAATGCTGAAAGCATTGCTGACTAA
GTGTCAAGTCATCGAGGGTTGAACCCATCAGATGAGCGTAGAGTGGCACGTAAATACCCACGGAGTGACGTTTGTTGTGATAGCGACGCGCTGAATGTCG
ATGTTGACGTTGTTGGTTAAATACCAAGGCATAACAACCCGGCTCATCGGATGCACGTGAAGTGGCACGTAATCTACGTGATGACAACTTCATGTCAACT
GGCTTGTAGTTGGATGTCGATAGCAACATCAGCTCTAGTTTAGATAAAATTACGTTTGATGATGGTATCGTTCAGAGAGATACGAATCACATAGTGTGTA
ATGTGTCACAAAGTGATAATGATTATCAGCTGTATACACTCGTCAACGGAGTGACTAGTGCTTGTGATGGTAAAATTAGCTTCGGGGTATCCCTCGTTAA
GTTCTCTTTTCGAACTCGAAGAGTTGTCGGTCTATGAGTTTGATCACTCACTAGAGAATGGAGACCTTTCAGAGGTGGTAGTCATTCAACCCGACATCAT
AGAGTTGAACTCTTCTTCACGTTTGGATGAAGCCGTTCTGGAGGACACAAAAGCAGCACTCATTGCGCGAAGTGGGTCATCAATATTGAAAGACCCTCGT
GCTCCCTTTTATTTCTTAGTCAGGGAATTTCAAGGTGTGGTGTGCCACGATCCACCCTCTGTTCTACCTCCAGATAGATGTGTCCGTCATGAAATTGACT
TAGTTCATGGGACGAAATACTGTGTCATATGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGCCATTGATGACTTCTTTCGTGCTAAGTACGAGGCAGG
AATGATTCGTGAGAGTAAATCTACATGTTCTACACCGGCATTTCGTGTCAAAAAGCCGATTGGCAAGTGGCGTATTGTGAATGCTTACAAGCTTAATGCG
GCTACTTTTCCGGCAAAGACATACAGTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGTTGATGGAT
ATTATAAATGCGAGCGAGTGGTATTCCGCTTACAGCAGTGAGCACCCCGAGTGGTATGATATGGGAATGGCAGGTGATTTCCCAAGGGCTGTCTAATGCT
CCGACAACATTTAATCGTCTGGTGAAGCAACTTTTTGTGGTTTACGCACAGACGCACTTTGATGACATTTTTGTCCATAGTCGTGCCGAAGAAGGTTGGT
CAGATGTTAAAAATCACATCGGTCATTTACGAGCCGTGCTCGAGTGCATGCGCACTAATAAACTGTACGCCAACGCGTCTAAATGCATTTTTGGTGCAGG
GGAGGTTTCTTTTCTAGGATGTTTCTTTGGGAAGCGCGGCCTCAGAGCGGATCCCACTAAGGTCAAGGCTATAGTGGACTGGCCGATTCCTAAGAATCAA
AAAGACTTGCGTAAGTGGACTGGCATTACCAATTAATTACACAAATACAGTGAAAATTACGCTGATATGGCTCAGCCATTAACTGATCTCCTTAAGAAGG
ACACAGCTTGGCGTTGGGACAACACACATGATGACGCATTTCGGGCAATAAAGGAAAGACTCCTCCATGCTCCCATTTTTGCATTACCAAATCCTGAGTA
CCCTTTTCGTGTTGTCTGCGATACATCCGATTTTGCTATAGGCAGCGCCCTATTACAAACAGATGCTGCAGACCGCGAGCGAGTTATCGCATTTGAATCA
CGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATGACCAAGAGATACTTGATATGAAATATGCGCTCGTTAAATTTAGAGTCCATCTGCTTGGCT
CCAAGTCATTCATCGTCTATACGGATCATGCGTCATTACGCACGGCAACACAGTCGCCTCACCTCTCTCAAAGAATGGCTCGGTGGCTTTCCTTCTTTGC
GGAATATAACTTCGAGGTCAAGTATAAGCCAGGCAAACAAAATGTGTTAGCAGATGCTCTCTCTCGCAGACCTGATTCTAAGCTTGCTCATGTCACGCCT
TTGTCGTCTCCAATTAAGGAGTTAATTCGTGTAGCATATCCACGGGATTCTCAGTGTGTGGCATTCTTTCAAGCCCTTGGGAGTGAAGAATACAAGGACT
CGGACAGTCAATTATCGGCACGCTTGCGGGCCAGTCTACATCTATATTCCATCGATAATGGTCTCTTGTGATATCGCAAAGATGTAGCGGATACCGCTCG
CATTGTGCCTCACAATGAGGATTTAAAATATCGAATCCCGTTTGAGTCCCACGATACTGCCCTCAGTGGGAATTTTGGCCGGGAAAAGACTTATGGCTTT
GTGATTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATAAGTGCGTACATTGGAAACGTGCTAGAGGGTCAAAACCTCAGCACATTCGG
CTGCGCCACTCGCCAGTTTACCTTTGCTCACGGGGTGTTGGGAGTCCATCAGTATGGATTTTGTGTTCGGGCTTCCTAAAGATAGTGACGAAAATACGGG
TACTGTGGTCTTTGTTGGCCGTTCAAGCAAGATGGCTCACTTAGCGGCAGTGCCGGATTCCATCGATGACAAAGGTACAGCTATGCTGTTTATCGATCGT
GTGTTTCTTCAAGACGGGTTGCCGCTAGCAATCATCTCTGATAGCGACCCTCGCTTCACAGGCAAGTTTTGGACTTCCATTTTCAAGGTGGTTGGTACGC
GAAAAAACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAGACTGAGCGAGTTAATCGTGTCATCGGCGACGTCTTCGCAGTGTTTGTGCTGAGCCG
CCTAAGTCTTGGAGCTCGATGCTCCCTGTCATTGAGTTTGTTTTGAACAACGCTGTTCATGCCTCGACGGGCGTTACTCCCTTCTATGTGAATAGCCTCA
CCCCCCCTCCCGCGTTTCGCTCACGTTACCACTACATGTTCTGGTCTTGGTGGGGGTGAGTCTGCTGACAAGCTTGCTGAAATCAGCCTTACTACTGTGC
AGAAACAAGTGAGCGAGTTTCTCGCGAAGTGCTTTAGTGTCGTACGACATATGCGTGATGCAATGGCTGATAGCCAAGACAGACAAAAAGAATAAGCTGA
TGCTAAAGGCAGAGGATGTATTGATTCTTATGAAGTTCGAGACCAAGTCTTATTAAATGCTAAAAACCTACCTTCAAATATATTGTCTGCCGTCTTCAAG
ACGAAATTGCGTCCGCGCTTCATTGGACCGTTTACGGTCATAGCGAAAAAAGGCCTTGCATATACGCTCAATCTCCCGCGCAAGTTGCGCACACAACCAG
TGTCTTACGTTGGCTTGCTTAAGCCATATCATGATCCT