Description :
From Genome Similarity Track
Location :
Scaffold_1603:1851- 3328
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1603-fgenesh-gene-0.1Glucose transporter

Sequence
1477 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCATCCACGCGACGAATACGCTCGCGTAGAGAGCCCACGTAGGGC
TGAAGGACGGGATCGCGATTTTCTTGGCCGAGTCGAGAGCCGCCGACGGCGTGGTCACCTCGAGGTACATGGGCTCAGCGGCCGTGGGCTCGGGTGTCTG
CACCATGATCAGCTAGTTGCTTGTGGGCTTGGGAGCAGATTGGGGAATGTCGGAGACGAACGAGGAGCTACGGGTAGTCTGGTTGTGGGACCCGCCACTC
ATTTTGCGACCTGCCAGCAAGCCAGTAGGTTAGCATGCATGCAGACTTGAACGTGGCGCAGTCAACTGATCTACTGAGTCGCATCCTTCAAGCGACACAG
GCCCTCCGAGCCAATCGCTGGACACGATGGAGCGCGCCATCTGCTTGCCATGTCACAAAAAACCTCTCTAGAATGTATACCTGTTTCATTTGTTATTTCT
ACGAATATTGTTTTAGACAGGATACCAAACACAATGACTTGAGAGGGCAACATTAAAACCTATGATATGTAATAAATAGGATGTTACTGCTCCGGCTGAA
TGCGTGCACATTGCGTGCATGAGAAGGGCATGCGTGTCAAAGATACGCTCGCTCGCCGGCTCGCTTTCAGTAACTACGGGCTTGCGCTCTTCAGGAGATA
TCCGCTGGGGGCTCTGCATGCGATACGATAGTCGATTCCCGGTGCTCTGGTAGCTCAACTCCATTGCCCCCCTTCGCGTAGTGGTCATCGCACCAGAAAT
GGCACACGAGCGTCCACTACATGTAGACAAACGCACCTCCCAAGAGCTCATCTCCTGCTGTCCTCCCTGCCTGCACAAGGCGACATTCAAGAGCCCTTCT
CAGGACTGAAGCAATGTTGGCAGCGAGGGCTTCAATCACACCAAGTTCCAGACACGAACGTTTGACGGACGCTGGGTAGCCGAGACGACTGGAGGGCTAG
ATGCTGTCGCAAAGTGTGGTAAGTGGCGCCAGGCGTGCTGGATCCCTGACTCATTCGCCACAGCCTCGTGCATCACCTGACCACGCACATTACCACACAA
GACGCAGTTCATCATCCACGTTTCATGCAACGTGCGAGCAAGCTGCTGATCTTACTGCACAGTGAGCTCTGTATGTCTTGCGACAAAACTAAAAAAAGTG
ACAGCGTCAAATTTGAACATTCGATGACTTTGACTTCCGAGAAGTCAAAGTGCAAAACGCTTTCTTGACAACAAACC