Description :
From Genome Similarity Track
Location :
Scaffold_112:185079- 186167
Sequence
1088 bases(100 bases per row)
CATGAGCATGCGCCCCAGGCGATTCAAAATGATTCAGGAGCAAACAACCCACGTTGGCTTTATCGCCCAGGAAATGCATGAGGTCATCCCTGATGCCGTT
TATATCGGCGCCAATGATGATGTAAATCAAGAAGGGTTTCCAATTAACCCATGGGGCATTGATCTAGCTAGTCTGACATCGGTTTTAGCGCGAGCGATCC
AAGAGCAACAAGGTCAAATCGAGGAGCTAAAAACAAAGAGCTTGCTCAGCTTAGAGCTTAAACGTGCGGCTTTTTTTGGGGTTCAGAGTATGTCCAAACG
CTACCACCCGGTTTGGAGGCCTTAAACGCGCTATCAGCGATAGTCGGGTCTTTCACTACCAGCTTATCCATGAGCGATTTCAGCTCCTTTAGGTTGCTTC
TCGCTTCGCGCTGGTACGCGTTCTTCGTGTCGACGAGTCTAGTATTGATGAATATCATGATATTTCTATACAATAGCAACCAAACCTCCTTGAATTCGTT
ATCCGAAATTAGCTTTGCTGTGTACATGTCAATCAATACCTGCTTGAGTTCGCGGATCAGGCTCGGGTGGTTATTGCCAAGCATCACTTCTCCCCTCAGT
TTGATGTACTCTTGCTTGAGTACCTCGCGAGGATCCTTGATGGGATCACGTAGCGCATGCTGGGTATGCGTAATGCGCAGGAGCTCGTGGAATACTCGTC
GATCATCCACGGACATCGAGTCGTAGAGCTGTTGATCGATGTTGCCATCGAATACCAAGGTCTTGATTAGCTTTGTTAGGTCATCGCTGATCTTGCGCTG
AGGACCGACTGTCGAGCGGTTCGGGTATACAACCTTGAGGAGACCGTCATTGAGCTTTGGTAGATGCACAAACTTGGTACCAATCCGCTTGTATGCAAGA
GCAGAAGCAGATCCCGAGCCCTCTAGCTGCGCGAGCTTGTATCCTCGGTTAGAGTGATATTTGATCGGATTACCATCACGGTCTCGAAGATCTTGCATGC
GCTTGACGTATCCGGCGCCTCGTAATCCTCGACCACTGACAGCAGCTGGTTTCATCTCCAGATCCTCCATCCGCATTGGTTCATCGCG